Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... and fragmented by heating at 94 °C for 3 min in 5× First Strand Buffer (Invitrogen). The fragmented mRNAs were reversely transcribed into cDNA by SMARTScribe reverse transcriptase (TaKaRa) ...
-
bioRxiv - Cell Biology 2022Quote: ... passage 3 fibroblasts were trypsinized 5 min at 37°C using 0.05% trypsin with EDTA (Gibco), centrifuged at 1000 rpm for 5 min at RT and resuspended in HBSS (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was generated using either the Superscript 3 or 4 First Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... pET15b-CDA5 was amplified using primers 3 and 4 and added to the BsiW1 (Thermo Fisher) site of pSLIK using InFusion (Takara ...
-
bioRxiv - Biochemistry 2022Quote: To prepare samples a 3:4 dilution was made in NuPAGE LDS sample buffer (ThermoFisher; NP007) supplemented with 10% v/v β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% glycerol) were separated on 3-8% Tris-acetate or 4-12 Bis-Tris gels (Thermofisher). Proteins were then transferred to PVDF membranes (Merck).
-
bioRxiv - Microbiology 2020Quote: ... All PBMCs were stimulated for 3-4 days with 2ug/ml of phytohemagglutinin (PHA; Gibco BRL) and 1 ug/ml of interleukin-2 (IL-2 ...
-
bioRxiv - Cancer Biology 2022Quote: 500000 cells in suspension were loaded with 3 μM Fluo-4 AM (Thermo Fisher Scientific, F14201) in DMEM without serum supplemented with 0.02% Pluronic-F127 (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNAs for 3 to 4 independent experiments performed in triplicate were extracted by Trizol (Ambion) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and MCR:SATB2 (45-3 and 63-4) cell lines were cultured in DMEM medium (Life Technologies) supplemented with 10% heat-inactivated FBS (Atlanta Biologicals) ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... the dissociated DA neurons were incubated with 3 μM Fluo-4 AM (Thermo Fisher, USA, F14201) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... and then for 3-4 h with 50 μM Click-iT® HPG (L-Homopropargylglycine) (Invitrogen). For gel electrophoresis analysis ...
-
bioRxiv - Microbiology 2023Quote: ... during a 3-day culture followed by 4 days of incubation with 10% FBS (Invitrogen, USA) as previously described[43] ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mL of the homogenized suspension was treated with 3 units/mL Rnase-free Dnase (Ambion) for one hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on NuPage 3-8% or 4-12% Bis-Tris precast gels (ThermoFisher Scientific) and transferred to nitrocellulose ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 3 µL of each DNA library sample was run on a 4% E-Gel (Thermo Fisher) and densitometry was performed with Fiji to account for differences in library yields ...
-
bioRxiv - Genetics 2024Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were then incubated in secondary antibodies (diluted in 5% serum in PBT at 4°C for 2–4 days): Alexa 488 anti-Chicken IgY (Invitrogen A11039; 1:400); Atto 647N anti-mouse IgG (Rockland 610-156-121 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight (4° C) with 5 µg of Cx36 (Thermofisher, 37-4600, RRID: AB_2533320) or NMDAR1 (Thermofisher ...
-
bioRxiv - Immunology 2024Quote: ... for 5 minutes at 4°C before quenching in 1x Phosphate Buffered Saline (PBS; Gibco). Cell viability was quantified by staining with Acridine Orange/Propidium Iodide at a 1:1 dilution in a Cellometer slide before reading on an Auto2000 Cellometer (Nexcelom Biosciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2020Quote: ... were quantified in autaptic neuronal cultures using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43, Thermo Fisher Scientific, Waltham, MA, USA), similarly as in our previous report (Kawano et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... were visualized using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43FX, a fixable analog of FM1-43 membrane stain, Thermo Fisher Scientific, Waltham, MA, USA). To stain the presynaptically active synapses of autaptic cultured neurons ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... Reverse 5′-CGA AGG TGT GAC TTC CAT G-3′) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2022Quote: ... HUVECs (passages 3-7) were washed with phosphate-buffered saline (PBS, ThermoFisher) and detached by trypsin/EDTA solution (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... Apoptosis was assessed using the CellEvent Caspase-3/7 Detection Reagent (Invitrogen) over TCB-treatment duration or at specific intervals ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the QuantStudio 3 and 7 Real-Time PCR systems (Applied Biosystems).
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Immunology 2021Quote: ... and Fc receptors were blocked with Fc block mAb clone 2.4G2 for 15 minutes at 4°C prior to surface staining for 30 minutes at 4°C with anti-CD4 (clone GK1.5 EF450, Invitrogen) and anti-Vβ3 TCR clone (clone KJ25 ...
-
bioRxiv - Immunology 2023Quote: ... and Fc receptors were blocked with Fc block mAb clone 2.4G2 for 15 minutes at 4°C prior to surface staining for 30 minutes at 4°C with anti-CD4 (clone GK1.5 EF450, Invitrogen) and anti-Vβ3 TCR clone (clone KJ25 ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were next stained with 4’,6-diamidino-2-phenylindole (DAPI) (4 μg/mL) (Thermo Scientific) and analyzed using the BD LSRFortessa cell analyzer (BD Biosciences ...