Labshake search
Citations for Thermo Fisher :
5801 - 5850 of 7821 citations for HEPACAM Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... we used TaqMan probes for human HTT and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNAs obtained from Applied Biosystems. Relative HTT gene expression was determined using the ddCt method ...
-
Inositol depletion regulates phospholipid metabolism and activates stress signaling in HEK293T cellsbioRxiv - Cell Biology 2022Quote: Human ISYNA1 isoform 2 (UniProt classification) was cloned into a pcDNA4/TO mammalian expression vector (Thermo Fisher Scientific). The cDNA was amplified by PCR (forward primer ...
-
bioRxiv - Genomics 2020Quote: ... LECs were stained with probes designed to target human LETR1 (Type 1 Probe, VA1-3018146, Thermo Fisher Scientific), human Malat1 (positive control ...
-
bioRxiv - Immunology 2021Quote: ... Alexa Fluor 647 anti-human CD137 (clone 4B4-1; dilution 1:100; Thermo Fisher Scientific; Cat no A51019); PE anti-human CD134 (clone OX40 ...
-
bioRxiv - Molecular Biology 2021Quote: ... T cells were either frozen or stimulated for 2 days with anti-human CD3/CD28 magnetic Dynabeads (ThermoFisher) at a bead to cell concentration of 1:1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumor genomic copy number was also assessed using the Genome-Wide Human SNP array 6.0 (Thermo Fisher Scientific). DNA prehandling and array hybridization were performed according to the manufacturer’s instructions (Affymetrix ...
-
bioRxiv - Physiology 2020Quote: ... RNA isolation of human left ventricular biopsies was performed with TRIzol (Invitrogen/ThermoFisher Scientific Inc., Waltham, MA, USA). The cardiac tissue samples (0.3 – 5.4 mg ...
-
bioRxiv - Bioengineering 2019Quote: Human adult fibroblasts were harvested and re-suspended at 1.5×106 cells/mL in dermal proliferation media (ThermoFisher, DMEM-High Glucose supplemented with 1% Pen/Strep ...
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: ... Bound cynomolgus monkey antibodies were detected with alkaline phosphate-labeled goat-anti-human IgG (1:1000, 4HI1305, Invitrogen Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... T cells were isolated using Dynabeads Untouched Human T Cells Kit using manufacturer’s protocols (Thermo Fisher, Waltham, MA). Isolated T cells were kept in T cell media ...
-
bioRxiv - Genomics 2019Quote: Immortalized human astrocytes (51) were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) plus 10% fetal bovine serum (FBS; Invitrogen) on fibronectin-coated (F1141 ...
-
bioRxiv - Immunology 2019Quote: ... and anti-human HLA-DR conjugated to eVolve 605 (clone LN3, cat. no. 83-9956-41, Affymetrix-Ebioscience). For bulk RNA-seq datasets ...
-
bioRxiv - Microbiology 2019Quote: ... and human monocytic leukemia (THP-1) cells (TIB-202; ATCC) cell lines were maintained in RPMI medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... was analyzed using Affymetrix Human Transcriptome Array 2.0 (HTA 2.0) microarrays after cDNA amplification using GeneChip WT Pico Reagent Kit (Affymetrix) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... were co-cultured on irradiated murine embryonic fibroblasts in human embryonic stem cell medium [DMEM/F12 (ThermoFisher Scientific), 20% Knockout Serum Replacement (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Human U2OS cells and mouse 3T3 cells were counted using the Countess II automated cell counter (Thermo Scientific) and fixed with 2% formaldehyde using the Arima Hi-C Kit (Arima) ...
-
bioRxiv - Immunology 2021Quote: ... T cells were activated using a 1:1 ratio of DynaBeads Human T-Activator CD3/CD28 (Thermo Fisher) for 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Human embryonic kidney cells (293T; ATCC; ATCC CRL-11268) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco), 10% fetal calf serum (FCS) ...
-
bioRxiv - Microbiology 2021Quote: ... Both human and simian hepatocytes were maintained at 37 °C in 5% CO2 in William’s E medium (Gibco) supplemented with 10% fetal clone III serum (FCS ...
-
bioRxiv - Neuroscience 2021Quote: ... and a mouse monoclonal antibody against human KMO (# 60029-1-Ig 1:1000, Thermo Fisher Scientific, Massachusetts, EUA). The membranes were washed and incubated for 1 h at room temperature with an HRP-conjugated secondary antibody (1:10000 ...
-
bioRxiv - Biochemistry 2020Quote: CD3/CD28 Dynabeads were removed from stimulated primary human CD4+ T cells using a DynaMag-2 magnet (Invitrogen). For antibody staining ...
-
bioRxiv - Bioengineering 2020Quote: The human fetal osteoblast (hOB) 1.19 cell line (ATCC) was expanded at 33.5°C in DMEM/F12 media (Gibco) containing 10% FBS (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Human phospho-tau [pT181] was measured using a commercially available ELISA per manufacturer’s instructions (Thermo Fisher Scientific, KHO0631). Guanidine extracted supernatants of hippocampus homogenates described above were utilized for the pTau ELISA.
-
bioRxiv - Immunology 2020Quote: ... and mouse anti-human HLA-DR antibody (Thermo Fisher Scientific, USA, 1:100, 2 h at 37°C). Also ...
-
bioRxiv - Neuroscience 2020Quote: ... Total Tau, phospho Tau (pS396, pS199, pT231 and pT181) levels were analysed by Human ELISA Kit from Invitrogen. Cerebral organoids and supernatants (for Aβ ...
-
bioRxiv - Cancer Biology 2021Quote: MMP1 in the secretome of cell lines was quantified with a MMP1 Human ELISA Kit (Thermo Fisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... and then with the following secondary antibodies: goat anti-human IgG (H+L) Alexafluor 488 (Invitrogen, 1/200), goat anti-mouse IgG2b Alexafluor 647 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblasts were isolated from normal human skin and cultured in Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific) supplemented with 10% fetal calf serum ...
-
bioRxiv - Cell Biology 2021Quote: ... The human hepatocellular carcinoma cell line HepG2 and the human embryonic kidney (HEK293T) (mycoplasma free) were cultured in Dulbecco’s Modified Eagle’s Medium (Gibco) and DMEM/F12 (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... gondii tachyzoites parental and derivative strains were grown in confluent human foreskin fibroblasts (HFFs) maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 5% fetal calf serum (FCS) ...
-
bioRxiv - Neuroscience 2020Quote: Human embryonic kidney 293T (Hek293T) cells were maintained in T75 flasks containing Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse embryonic fibroblasts (MEFs) in human embryonic stem cell (hES) media composed of Knock-out Dulbecco’s modified Eagle’s medium (DMEM) (Gibco), 10% knock-out-serum replacement (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... the plates were incubated for 1 hr with horseradish peroxidase-(HRP) conjugated anti-human IgG1 (Thermo Scientific, A10648). Detection was performed using a two-component peroxidase substrate kit (BD biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Bound antibodies were detected by addition of horseradish peroxidase-labeled goat-anti-human IgG (Invitrogen, Carlsbad, CA, USA) followed by 1-Step Ultra TMB (ThermoFisher ...
-
bioRxiv - Pathology 2021Quote: ... followed by two TBT washes and incubation using a pTau AT8 mouse anti-human primary antibody (Thermofisher MN1020) at a dilution of 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended in 250 μl PBS-B containing anti-human AlexaFlour-488-conjugated antibody (1:200; Thermo Fisher Scientific) and incubated again for 60 min at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and human RNase P (RP assay) together with TaqPath™ 1-Step RT-qPCR Master Mix CG (ThermoFisher). A plasmid containing the complete nucleocapsid gene from 2019-nCoV (IDT ...
-
bioRxiv - Bioengineering 2021Quote: Primary human T cells were thawed at Day 0 and activated with anti-CD3/CD28 Dynabeads (Thermo Fisher) at a 3:1 bead to T cell ratio and cultured in AIM V + 5 % heat-inactivated FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... MCF10A human mammary epithelial cells (ATCC) were cultured in 1:1 DMEM/F-12 (Thermo Fisher Scientific, USA) media which consists of 2.50 mM L-Glutamine and 15 mM HEPES buffer ...
-
bioRxiv - Microbiology 2019Quote: Human HaCaT epithelial keratinocytes and Vero cells were propagated in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: The siRNA duplex (21 nucleotides) against human cath-D siRNA (ID 4180) was purchased from Ambion (Austin, TX), and the firefly luciferase (Luc ...
-
bioRxiv - Cell Biology 2021Quote: Human epithelial colon adenocarcinoma, Caco2, cells (ACC 169, DSMZ, Leipzig, Germany) were grown in DMEM/F-12 (Gibco, Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Biophysics 2021Quote: The pTWIN1 vector containing human Httex1 fused to His6-SUMO was ordered from GeneArt Gene Synthesis (Life Technologies); E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then stained with 5 µL FITC anti-human DR4 (Thermo Fisher Scientific, Clone DR-4-02) for 30 min at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The control human IgG antibody for in vitro and in vivo studies was from Invitrogen (Carlsbad, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... 2011) were grown in human foreskin fibroblasts (HFF) monolayers in Dulbecco’s modified Eagle’s medium (DMEM) with GlutaMAX (Gibco) supplemented with 10% Nu-Serum (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... The human NPCs sourced from Polymenidou group (UZH) were plated in media supplemented with DMEM/F12 (Thermo Fisher), 0.5X B27-supplement (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: The human colon adenocarcinoma cell lines LS174T (derived from Caucasian colon adenocarcinoma) maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS (BI ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were incubated with primary antibodies such as rabbit anti-human ZO-1 IgG (Thermo Fisher Scientific) and mouse anti-human albumin IgG (Thermo Fisher Scientific ...