Labshake search
Citations for Thermo Fisher :
5451 - 5500 of 7745 citations for Recombinant Human PPIA His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: PXR siRNA (siRNA NR1I2 silencer human, s16909, Life) transfection experiments were performed using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: Human embryonic kidney (HEK-293T) ASIC-KO cells25 were maintained in Minimum Essential Medium (Gibco #11095) supplemented with 10% EqualFetal Bovine Serum (Atlas Biologicals #EF-0500-A) ...
-
bioRxiv - Cell Biology 2024Quote: ... Human MCF10A breast epithelial cells were cultured in DMEM/F12 (DMEM/Nutrient Mixture F-12, Gibco) supplemented with 5% fetal horse serum (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: Cystatin A concentration was assessed using a Human Cystatin A ELISA kit (Invitrogen, catalog no. EH140RB). Total cell lysates were extracted from CAR T cells using radioimmunoprecipitation assay (RIPA ...
-
bioRxiv - Biochemistry 2024Quote: ... which were co-transfected into human U251-MG glioblastoma cells (ECACC 09063001) using Lipofectamine 3000 (ThermoFisher). Transfectants were selected for three days at which point selection antibiotic was removed ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with goat polyclonal anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caco-2 (human, intestine; HTB-37, ATCC, RRID: CVCL_0025) were cultivated in minimum essential medium (GIBCO) supplemented with 10% FCS ...
-
bioRxiv - Neuroscience 2024Quote: ... The human GBA1 sequence was detected using TaqMan Gene Expression Assays (Thermo Fisher Scientific Inc., Hs00986836_g1). The primer/probe sequences used for the detection of beta actin ...
-
bioRxiv - Neuroscience 2024Quote: ... FAM labelled probes used during amplification included probes targeting Human SOD1 and Mouse HPRT (Applied Biosystems). Gene expression was calculated using the ΔΔCT method.
-
bioRxiv - Microbiology 2024Quote: Human foreskin fibroblasts (HFFs) were cultured in Dulbecco’s Modified Eagle Medium from (Invitrogen, cat# 11965-118) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: The human Burkitt lymphoma cell line (BJAB) was cultured in Dulbecco’s modified Eagle medium (DMEM,GIBCO) supplemented with 10% heat-inactivated fetal calf serum ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subject to reducing SDS-PAGE and immunoblotted using antibodies recognizing recombinant protein (anti-NRG1 NRG1abcam ab180808 1:5000 dilution in 5% milk) or Lamin A (Invitrogen MA1-06101, 1:1000 in 3% BSA).
-
bioRxiv - Immunology 2021Quote: ... T-cells were stimulated with Dynabeads Human T-Activator CD3/CD28 (ratio 1:2, Thermo Fisher Scientific) in the presence of PBMC-derived CECs (ratio 1:2 ...
-
bioRxiv - Immunology 2021Quote: ... Protein secretion levels in culture supernatant were quantified via ELISA for human IgG (Invitrogen, 50-112-8849) and human BAFF (R&D Systems ...
-
bioRxiv - Genetics 2021Quote: Immortalized Human Embryonic Kidney cells (HEK293T) were cultured in DMEM (high glucose, L-glutamine, sodium pyruvate; Gibco) supplemented with 10% Hyclone Fetal Bovine Serum (GE Life Sciences) ...
-
bioRxiv - Molecular Biology 2021Quote: U2OS human osteosarcoma cells were obtained from ATCC and grown in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS) ...
-
The key features of SARS-CoV-2 leader and NSP1 required for viral escape of NSP1-mediated repressionbioRxiv - Molecular Biology 2021Quote: Human HEK293T cells were grown in Dulbecco’s modified Eagle’s medium with GlutaMAX™ supplement (DMEM+ GlutaMAX, GIBCO) with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... was cultured in O+ human erythrocytes at 4% haematocrit in RPMI 1640 supplemented with 0.25 % albumax (Invitrogen), 5% heat-inactivated human serum and 0.25% sodium bicarbonate in gassed chambers at 1% O2 ...
-
bioRxiv - Immunology 2022Quote: ... soluble extracellular domain (ECD) of human CD58 was produced either in Freestyle 293F suspension cells (Thermo Fisher) or adherent HEK 293T cells ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (male WTC11 background77) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... primary Hs27 human fetal foreskin fibroblasts (ATCC Cat#CRL-1634) all maintained in DMEM (Gibco Cat# 11995065) supplemented with 10% FBS and 1% antibiotic/antimycotic ...
-
bioRxiv - Molecular Biology 2021Quote: ... we modified the default protocol of the Ion AmpliSeq Transcriptome Human Gene Expression kit (Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: Human or mouse CDCs were transfected with small interfering RNAs against Drosha (Thermo Fisher HSS178992 or MSS274198) or a Medium GC Content Negative Control (Thermo Fisher ...
-
bioRxiv - Bioengineering 2022Quote: Flp-In T-REx Human Embryonic Kidney (HEK) 293 cells were purchased from Thermo Scientific (catalog #R78007). Cells were cultured in a humidity-controlled incubator under standard culture conditions (37°C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Full-length human SAMD1 was produced by Cell & Molecular Technologies (CMT, Phillipsburg, NJ, now Invitrogen, Carlsbad, CA) in HEK293 cells ...
-
bioRxiv - Genomics 2020Quote: ... isolated single cells were stained with mouse anti-human CD34 biotinylated antibody (clone 581, Thermo Fisher Scientific) diluted 5µL for 106 cells in FACS buffer (DPBS with 2% FBS and 1mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... TNFα using the ProcartaPlex high sensitivity 9-Plex Human Panel (EPXS090-12199-901, Thermofisher Scientific, Waltham, MA). Samples were measured using a Luminex MAGPIX instrument (Luminex Corporation ...
-
bioRxiv - Microbiology 2020Quote: Human 293F cells were maintained at 37°C with 5% CO2 in FreeStyle 293 Expression Medium (ThermoFisher) supplemented with penicillin and streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: Human Embryonic Kidney (HEK-293) cells were cultivated in DMEM (Gibco®, Thermo Scientific, Carlsbad, CA, USA) supplemented with 10% FBS,2mM glutamine and 1% penicillin/streptomycin.
-
bioRxiv - Cancer Biology 2020Quote: Human Embryonic Kidney (HEK-293) cells were cultivated in DMEM (Gibco®, Thermo Scientific, Carlsbad, CA, USA) supplemented with 10% FBS,2mM glutamine and 1% penicillin/streptomycin.
-
bioRxiv - Genetics 2020Quote: ... reference primers/probe (VIC, TaqMan™ Copy Number Reference Assay, human, RNase P, 4403326; ThermoFisher, Waltham, MA)] and applied to a X200™ Droplet Generator (1864002 ...
-
bioRxiv - Neuroscience 2019Quote: ... Human synaptosomes were labeled with blue fluorescent 2.0 µm FluoSpheres™ Carboxylate-Modified Microspheres (Life technologies, F8824) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... After an overnight rest 20 μL of Dynabeads™ Human T-Activator CD3/CD28 (Thermo Fisher #1131D) were added per well and incubated for 24 hours ...
-
bioRxiv - Bioengineering 2019Quote: ... 10x of mouse (for NIH 3T3 cells) or human (for HCT116 cells) Cot-1 DNA (Thermo Fisher Scientific Cat ...
-
bioRxiv - Immunology 2019Quote: Human peripheral blood or umbilical cord blood was diluted with an equal volume of RPMI-1640 (Gibco), overlaid on Histopaque (Sigma) ...
-
bioRxiv - Immunology 2019Quote: Cryopreserved T cells were thawed and activated same day with Human T-Expander CD3/CD28 Dynabeads (Gibco) at 3:1 beads:cell ratio in T cell media (AIMV supplemented with 5% FBS ...
-
bioRxiv - Developmental Biology 2020Quote: Primary prenatal human microglia were MACS-purified as described above and labeled with DiI (Thermo Fisher, V22885) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Alexa Fluor conjugated secondary antibodies used: goat anti-human Alexa-488 (1:1000, Cat. # A11013, Life Technologies), donkey anti-mouse Alexa-594 (1:1000 ...
-
bioRxiv - Systems Biology 2019Quote: Full-length cDNAs were obtained from the human ORFeome v5.1 entry clone collection (Thermo Fisher, Open Biosystems) and sequence verified ...
-
bioRxiv - Immunology 2019Quote: ... Corresponding cDNAs were made by gene synthesis and codon-optimised for expression in human cells (Invitrogen, GeneArt). The ectodomains were flanked by unique NotI and AscI restriction enzyme sites and subcloned into an expression plasmid containing a high-scoring signal peptide [29] ...
-
bioRxiv - Microbiology 2019Quote: ... transformed into MaV203 and used as a bait to screen a human embryonic brain cDNA library (Invitrogen). Media ...
-
bioRxiv - Biochemistry 2019Quote: ... the human cell lines were seeded (1000 cells/well) using a multi-drop Combi (Thermo Fisher Scientific) on top of the compounds ...
-
bioRxiv - Microbiology 2021Quote: Human embryonic kidney 293 Freestyle (HEK293F) cells were maintained in Expi293 Expression Medium (Gibco, Waltham, MA, USA), at 37 °C in an 8% CO2 atmosphere ...
-
bioRxiv - Immunology 2021Quote: ... Human or mouse cell suspensions were seeded at approximately 2900 cells/cm2 in αMEM complete media (Invitrogen) and cultured in 10% batch selected FBS (Sigma Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... Human PDCD1 or PDL1 cell surface protein staining was analyzed using anti-PD-1 (ThermoFisher clone MIH4) or anti-PD-L1 (ThermoFisher clone MIH1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the medium was changed to human endothelial serum-free medium (HESFM, Thermo Fisher Scientific, cat no. 11111044) supplemented with 20 ng/mL bFGF (Peprotech ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from HEK293 cells and human brain prefrontal cortex were isolated with the TRIzol reagent (Ambion) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... Caco-2 human colorectal adenocarcinoma (ATCC HTB-37) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (GibCo) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2020Quote: Human colon adenocarcinoma cells (Caco-2) were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...