Labshake search
Citations for Thermo Fisher :
5251 - 5300 of 7745 citations for Recombinant Human PPIA His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: The human Tara coding sequence was amplified by PCR and cloned into the pPC97 vector (Invitrogen). Host Saccharomyces cerevisiae strain MaV203 cells were co-transformed with pPC97-Tara and human fetal brain cDNA library plasmids cloned in pPC86 (GibcoBRL) ...
-
bioRxiv - Genomics 2022Quote: Beating human iPSCs were switched to Opti-MEM™ Reduced Serum Medium (ThermoFisher Scientific, Waltham, MA). LINC000881 knockdown was achieved by lipofectamine based transfection of antisense LNA GapmeRs designed against LINC00881 versus scrambled oligonucleotide (QIAGEN ...
-
bioRxiv - Genomics 2022Quote: ... Beating human iPSCs were switched to Opti-MEM™ Reduced Serum Medium (ThermoFisher Scientific, Waltham, MA). LINC000881 overexpression was achieved by lipofectamine based transfection of LINC00881 plasmid versus bacterial alkaline phosphatase control plasmid using RNAiMAX reagent (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were isolated using a commercial kit (MagniSort Human CD4+ T Cell Enrichment; Affymetrix) and infected by incubation for 4 h at 37°C with 156,250 or 2,500 TCID50 (50% tissue culture infectious dose ...
-
Nucleoli and the nucleoli-centromere association are dynamic during normal development and in cancerbioRxiv - Cell Biology 2022Quote: The RD human rhabdomyosarcoma cell culture line was acquired from ATCC and cultured in DMEM (Gibco) with 10% Fetal Bovine Serum (Hyclone ...
-
bioRxiv - Cell Biology 2022Quote: Human A549 and mouse LUAD cells were cultured in high-glucose DMEM (Life Technologies #11965-092) supplemented with 10% FBS and 1% penicillin/streptomycin (“full DMEM” ...
-
bioRxiv - Immunology 2022Quote: ... The secreted fusion protein was purified on a CaptureSelect™ human albumin affinity matrix (Life Technologies), and protein eluted by adding 20 mM Tris and 2.0 M MgCl2 ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells were positively enriched by Magnisort Human CD8+T cell positive selection Kit (Invitrogen). Nuclear fraction was isolated using NE-PER Nuclear and Cytoplasmic extraction kit (ThermoFisher) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Immunology 2020Quote: ... 0.05% Tween-20 (PBST) and ALP-conjugated goat anti-human IgG (H+L) antibody (Thermo Fisher) was added into each well and incubated at 37°C for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: ... Background binding level in ELISA assays was measured using Human IgG Isotype Control (ThermoFisher #02-7102).
-
bioRxiv - Molecular Biology 2021Quote: ... Binding of the antibodies was detected using Alexa fluor 633 conjugated anti-human IgG antibodies (Invitrogen). Expression of the surface-displayed myc-tagged RBDs was detected using a FITC conjugated chicken anti-myc antibody (Immunology Consultants Laboratory ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney-293T (HEK-293T) cells were maintained in DMEM (Thermo Fisher Scientific, Cat. 11965118) containing 10% fetal bovine serum (GEMINI ...
-
bioRxiv - Immunology 2020Quote: ... 50μL of polyclonal anti-human β2M HRP-conjugated IgG detection antibody raised in rabbits (ThermoFisher Scientific), diluted 1:2500 in 2% BSA (0.2μg/mL) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 mL media or media containing Dynabeads human T-activator anti-TCR/anti-CD28 (Gibco, 11132) (1 bead/cell ...
-
bioRxiv - Microbiology 2021Quote: ... Alexa488- or Rhodamine-conjugated goat anti-human secondary antibody was added (1/500 dilution) (Thermo Fisher), and incubated for 2~3 hr at room temperature in the dark ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids were transfected into HEK293 human embryonic kidney cells using Lipofectamine2000 (Invitrogen, Carlsbad, CA, USA). The recombinant proteins were purified with anti-FLAG agarose affinity gel (A2220 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human CD4+ and CD8+ T cells were distinguished with live/dead viability stain (Thermo Fisher Scientific), followed by human CD3 and CD8 (BioLegend ...
-
Mathematical characterization of population dynamics in breast cancer cells treated with doxorubicinbioRxiv - Cancer Biology 2021Quote: MCF-7 human breast cancer cells (ATCC HTB-22) were cultured in Minimum Essential Media (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: Primary human T cells were cultured in OpTmizer CTS T cell Expansion SFM (ThermoFisher, Waltham, MA) containing 2.5% CTS Immune Cell SR (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: Healthy human dermal fibroblasts of neonatal origin (HDFn) were cultured in DMEM GlutaMAX medium (Thermo Fisher) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Genomics 2022Quote: ... human preadipocytes in a 6-well plate were transfected with 6.25ug Cas9 protein (Fisher Scientific, A36498) and 800ng sgRNAs (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... cells were pre-activated with Dynabeads human T-Activator CD3/CD28 (Thermo Fisher Scientific, cat#111.31D) for 24 h and beads were removed before electroporation ...
-
bioRxiv - Immunology 2022Quote: ... silencer select siRNA for human FtH1 and negative control siRNA (4392421 and 4390843 respectively, ThermoFisher Scientific) were used ...
-
bioRxiv - Biochemistry 2022Quote: ... and pooled 50-donor human liver cytosol (Fisher Scientific, Hampton NH, Ref: HMMCPL, Lot: PL028-J) were protein normalized ...
-
bioRxiv - Pathology 2019Quote: ... Human bone cells (HBC) were cultivated in a proliferation medium consisting in α-MEM (Gibco®), 10% Fetal Calf Serum (FCS) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Human embryonic kidney (293) cells were cultured in Dulbecco’s modified Eagle medium (DMEM with GlutaMax, Invitrogen), supplemented with 10% v/v foetal bovine serum ...
-
bioRxiv - Genetics 2019Quote: ... Each gel included a migration standard comprised of Di-I labeled human LDL (L3482, ThermoFisher Scientific) that was diluted in cryoprotectant and stored in frozen aliquots (see recipes) ...
-
bioRxiv - Immunology 2019Quote: ... Isolated Vα7.2+ cells were activated with Dynabeads™ human T-activator CD3/CD28 (Gibco, ThermoFisher Scientific) at a ratio of 1:1 ...
-
bioRxiv - Immunology 2019Quote: ... Isolated Vα7.2+ cells were activated with Dynabeads™ human T-activator CD3/CD28 (Gibco, ThermoFisher Scientific) at a ratio of 1:1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... were cultured in Medium 254 (Invirogen, Portland, OR, USA) supplemented with Human Melanocyte Growth supplement (Invitrogen). All cells were cultured at 37°C in a humidified incubator under 5% CO2 ...
-
bioRxiv - Bioengineering 2019Quote: ... RNA from human cells was cleaned and collected utilizing an RNAqueous-Micro Kit (Ambion, cat. #AM1931) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Custom synthesized (IDT biotech) human KCNJ15 cDNA was sub-cloned into the PE1A plasmid (Invitrogen, #A10462), followed by gateway transfer of KCNJ15 into the lentiviral vector ...
-
bioRxiv - Immunology 2020Quote: ... The fibrinogen used here was isolated from human plasma and conjugated with AlexaFluor-647 (Invitrogen™).
-
bioRxiv - Physiology 2020Quote: Human or mouse islets were dissociated into a single cell suspension by enzymatic digestion (Accumax, Invitrogen). For each experimental condition ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human embryonic kidney 293 cells containing SV40 large T-antigen (HEK293T) were cultured in DMEM (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: The human GIPR DNA (Genewiz) with one mutation (T345F) was cloned into the pFastBac vector (Invitrogen) with its native signal peptide replaced by the haemagglutinin (HA ...
-
bioRxiv - Microbiology 2021Quote: ... a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies). Expi293F cells were grown in Expi293 Expression Medium (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... Sorted T cells were stimulated with Dynabeads® Human T-Activator CD3/CD28 (Thermo Fisher Scientific) (ratio 1:1 ...
-
bioRxiv - Cell Biology 2021Quote: ... murine or human serum94 in Dulbecco’s modified Eagle’s medium (DMEM, Life Sciences, Thermo Fisher Scientific, Germany) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: Human immortalized keratinocytes (HaCat) were cultured with Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Biophysics 2021Quote: Human immortalized keratinocytes (HaCat) were cultured with Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human BM-MSC lines were maintained in AmnioMAX™ with C100 supplement (Life Technologies, Carlsbad, CA); these lines were previously confirmed to express characteristic stromal markers (>95% CD90+ ...
-
bioRxiv - Immunology 2019Quote: ... T cells were then stimulated with anti-CD3/anti-CD28 human T-Activator Dynabeads® (Invitrogen) at a 1:2 ratio of beads to T cells ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the LDH CytoTox 96 kit from ProMega (Madison, WI), Urea Nitrogen Test from StanBio Laboratory (Boerne, TX) and human TNF-α from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2019Quote: Human embryonic kidney HEK293T and HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2019Quote: ... the human IL-2 ELISA kit was used in accordance with manufacturer’s instructions (Thermo Fisher Scientific). Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2019Quote: 293T (human embryonic kidney) and Hela cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Genetics 2020Quote: GM1604 human fetal lung fibroblast cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Life Technologies) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... near-confluent human ES/iPS cell colonies were treated with TrypLE Select Enzyme (Thermo Fisher Scientific) for 5 min at 37°C ...