Labshake search
Citations for Thermo Fisher :
5451 - 5500 of 10000+ citations for Recombinant Human FCGRT & B2M Protein His Avi Strep II tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... cell suspensions were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript® II Reverse Transcriptase (Invitrogen™, Life Technologies) was used for the reverse transcription step ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript® II Reverse Transcriptase (Invitrogen™, Life Technologies) was used for the reverse transcription step ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was reverse transcribed using random decamers and M-MLV reverse transcriptase (Promega)/Superscript II RNase H reverse transcriptase (Thermo Fisher Scientific). Quantitative RT-PCR was performed on a BioRad CFX Connect system using iTaq Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... and ultrapure hydrogen peroxide (ULTREX II, 30%, Fisher Scientific). 30 lysate ...
-
bioRxiv - Genomics 2020Quote: ... and SuperScript™ II Reverse Transcriptase (Thermo Fisher, 18064014) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 25 mM sodium bicarbonate and 0.25% AlbuMAX II (GIBCO) or 5% heat-inactivated human sera in O+ RBCs from malaria-naive donors (Australian Red Cross blood bank) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and reverse transcription was done with Superscript II (Invitrogen) as previously described 68 using primer AM Dscam 13R2 (GCCGAGAGTCCTGCGCCGATTCCATTCACAG ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-Collagen Type II (Thermo Scientific, MS235B, 1:100), anti-Collagen Type X (Quartett ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized with SuperScript II Reverse Transcriptase (Invitrogen) from 1 µg of RNA sample ...
-
bioRxiv - Cell Biology 2019Quote: Cells were cytospun using Shandon Cytospin II (Thermo Scientific), dried and fixed in methanol ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using SuperScript II (Thermo Fisher) and qPCR using 2x Takyon for SYBR Assay – no ROX (Eurogentec ...
-
bioRxiv - Immunology 2019Quote: ... Using Phusion Hot Start II DNA Polymerase (Thermo Fisher) and DNA template (up to 1 μg ...
-
bioRxiv - Biochemistry 2020Quote: ... and (ii) 6 μl of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2019Quote: ... and cloned into pCR II-TOPO TA vector (Invitrogen). An AvrII site was introduced abutting the runt stop codon ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was done using SuperScript II RT (Invitrogen) and qRT-PCR was performed using SYBR FAST Universal 2X qPCR Master Mix (Kapa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was generated using Superscript II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... containing 1 mg/ml collagenase II (Thermo Fisher Scientific) for 2 h at 37 °C in a shaking water bath ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using SuperScript II Reverse Transcription (Invitrogen). Real time quantitative PCR was performed with KAPA SYBR FAST Universal reagent (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 µL Phusion HS II DNA Polymerase (ThermoFisher #F549L), and water to 50 µL ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 µL Phusion HotStart II HF Polymerase (ThermoFisher #F549L), and 31 µL water ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1.5g/L Manganese (II) chloride (MnC12•4H2O, Acros Organics), 1.3g/L iron (III ...
-
bioRxiv - Cancer Biology 2019Quote: ... rinsed with Nu-Clear II (Thermo Fisher Scientific, REF6769009), and then rinsed again first with tap water and then with Bluing Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 20mg/L Cobalt (II) chloride (CoCl2•6H2O, Acros Organics), 10mg/L Ammonium heptamolybdate ((NH4)6Mo7O24•4H2O ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 21mg/L Copper (II) sulphate (CuSO4•5H2O, Acros Organics), 10mg/L Thiamine (Acros Organics) ...
-
bioRxiv - Cell Biology 2020Quote: ... A Gateway reaction using LR Clonase II Plus (Invitrogen) generated the pTol2-ubi:mito-Keima,cryaa:Cerulean vector following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen). Taqman® Assays for FOS (Hs00170630_m1) ...
-
bioRxiv - Biochemistry 2020Quote: ... and a Countess II Automated Cell Counter (Thermo Scientific) was employed to detect the percentage of cells with compromised membrane integrity.
-
bioRxiv - Biochemistry 2020Quote: ... or Nunc Lab-Tek II Chambered Coverglass (Nalgene Nunc/Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 µg of RNA using SuperScript II Kit (Invitrogen) were reverse transcribed to cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen).
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were counted using the Countess II (Life Technologies), 2500 cells were seeded in a 96-well plate ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the Gateway BP Clonase II Enzyme Mix (Invitrogen). pDONR221-JMa/CYT2 was purchased from Life Technologies (clone ID ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the Gateway LR Clonase II Enzyme Mix (Invitrogen). All constructs were verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using Superscript II Reverse Transcriptase (ThermoFisher) and random hexamers ...
-
bioRxiv - Plant Biology 2021Quote: ... and reverse transcribed with SuperScript II reverse transcriptase (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2020Quote: FluxOR II Green Potassium Ion Channel Assay kit (Invitrogen) is applied to estimate the transport activity of KCC3 WT and N-deletion proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The Thermo Trace GC-DSQ II system (ThermoFisher Scientific) consists of an automatic sample injector (AS 3000) ...
-
bioRxiv - Plant Biology 2020Quote: ... and anions (Thermo Scientific Dionex Seven Anion Standard II) were used and the data were extracted using the Chromeleon 7.2 SR4 software (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... and was ligated into pCR-Blunt II-TOPO (Invitrogen). A clone was generated that matched the predicted sequence from the de novo transcriptome ...
-
bioRxiv - Microbiology 2021Quote: ... DNAseI (Turbo) treatment and SuperScript Reverse Transcription II (Invitrogen) was performed as per manufacturer instructions to obtain cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... using Taqman Universal Master Mix II (Life Technologies, 4440040). Taqman probes used to target each gene of interest are as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissociated cells were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/μl ...
-
bioRxiv - Microbiology 2021Quote: ... and a direct detector Falcon II (Thermo Fisher Scientific).
-
bioRxiv - Systems Biology 2020Quote: ... were obtained from Thermo Fisher Scientific and cultivated in 293 SFM II medium (Gibco) supplemented with Glutamax at a final concentration of 4 mM (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 mg/ml dispase II (Gibco, 17105-041) at 37 °C for 2 h ...
-
bioRxiv - Cell Biology 2020Quote: ... subcloned into pCR-Blunt II-Topo vectors (Invitrogen, Inc.), and analyzed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 U/μL of Superscript II Reverse Transcriptase (Invitrogen) were added and samples incubated at 25°C for 10 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-prohibitin (clone II-14-10; Thermo Fisher Scientific), anti-calnexin (ab10286 ...
-
bioRxiv - Cell Biology 2021Quote: ... and dispase II (1.2 U/ml, Thermo Fisher, 17105041) in DPBS containing 0.9 mM Ca2+ for 45 min at 37°C and filtered through both a 40 μM and then a 30 μM filter to ensure a single-cell suspension ...