Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Genetics 2020Quote: ... and 400 µl of 5% aqueous formic acid (Optima grade, Fisher Scientific), vortexed for 30 seconds and centrifuged at 8000 x g for 2 min at 10° C ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 ml MEM Nonessential Amino Acids (Thermo Fisher Scientific, cat. no 11140035), 1 ml 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... + 5% FBS + non-essential amino acids (Gibco, Gaithersburg, MD-Stock# 11140-050), penicillin-streptomycin (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in 1 ml of 5% trichloroacetic acid (SA433, Thermo Fisher Scientific) and incubated at 4°C for a minimum of 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml of MEM non-essential amino acids solution (Thermo Fisher Scientific), 3.5 ml of 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... and were resuspended in 5% acetonitrile with 0.1% formic acid (Thermo Scientific). The resulting peptides were quantified by fluorometric peptide assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were treated with 5% periodic acid (Thermo Fisher Scientific, MA, USA) for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies, 11140050). At 4 days after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-Ethynly-2’-deoxyuridine (EdU; E10415, Thermofisher) was administered to mice via their drinking water at a concentration of 0.2 mg/ml for up to 21 consecutive days (as per 58) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was administered intraperitoneally (500 µg per animal ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% 2-mercaptoethanol (Thermo Fisher Scientific) was added 3:1 to an aliquot of each sample ...
-
bioRxiv - Developmental Biology 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) powder (Invitrogen) was dissolved in sterile PBS into a working concentration of 2.5 mg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2’deoxyuridine (EdU) (Life Technologies) at stated times at a concentration of 10 μM ...
-
bioRxiv - Cell Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen, C10418) was dissolved with 2 ml sterile PBS at the concentration of 5 mg/ml (20 mM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL Glutamax (2 mM, ThermoFisher 35050061), 5 mL Penicillin/Streptomycin (100 U/mL and 100 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL Glutamax (2 mM, ThermoFisher 35050061), and 5 mL Penicillin/Streptomycin (100 U/mL and 100 μg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridine, A10044, ThermoFisher) and Doxycycline Hydrochloride (1ug/ml ...
-
bioRxiv - Immunology 2024Quote: ... 5-ethynyl-2’-deoxyuridine (EdU, Thermo Scientific) was reconstituted at 5mg/mL in DPBS and injected at 50mg/kg i.p ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5μM 5-ethynyl-2’-deoxyuridine (Thermo Fisher A10044 or component of Click-iT® Alexa Fluor 488 reaction kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was injected intraperitoneally (0.3 mg/10 g of mouse weight ...
-
bioRxiv - Biophysics 2023Quote: ... polystyrene microspheres (rbead=2·5 μm; Thermofisher) were used to template the glass discs in a continuous gold film ...
-
bioRxiv - Cell Biology 2024Quote: ... with 10µM 5-Bromo-2’-Deoxyuridine (Invitrogen) being added for the last 6 h of treatments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-ethynyl-2-de-oxyuridine (EdU; ThermoFisher) was provided via intracardiac intravenous injection for chick embryos (E4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5-etinil-2’-desoxiuridina (EdU; A10044, ThermoFisher) is a small thymidine analogue that can be detected using click chemistry ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5mM EdU (5-ethynyl 2’-deoxyuridine, Invitrogen), 0.5mM EC (5-ethynyl cytidine ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) 4 mL modified SP-4 containing 40 mg/mL penicillin (Fisher Scientific, Hampton NH). Tubes 1 and 3 were incubated at 30 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Genetics 2022Quote: ... Ly6Chi monocytes were labeled by intraperitoneal injection of 4 mg/mL of Edu (5-ethynyl-2’-deoxyuridine) from Life technologies (NY), and mice were euthanized after 5 days to assess baseline recruitment or 21 days to assess for retention ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Genetics 2020Quote: ... boiled in reducing sample buffer for 5 min and resolved on 4–12% Bis-Tris Bolt gels and transferred using an iBlot 2 (Thermo Fisher). Blots were blocked in 2.5% milk in 1% TBS-Tween before staining with antibodies (Table S5) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were dissociated into single cells with TrypLETM for 4-5 minutes at 37 C and seeded into 2 % Geltrex coated 96- or 12-well plates (Fisher Scientific) in Essential 8TM Medium (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... A 3% agarose gel with 4 μL ethidium bromide was loaded with 5 μL PCR reaction and 2 μL GeneRuler 100bp ladder Plus (Thermo Fisher) and run for 40 minutes at 100 volts ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...