Labshake search
Citations for Thermo Fisher :
5301 - 5350 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Oligonucleotide probes were synthesized and labeled with biotin at the 5′ end by Invitrogen. The EMSA was performed using a Chemiluminescent EMSA kit (Beyotime ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... muscles were injected with 5 µM Fluo-4 penta-potassium salt (ThermoFisher Scientific, USA) as previously described and viewed with DIC optics on a Nikon Eclipse TE300 inverted light microscope (400× ...
-
bioRxiv - Genetics 2023Quote: ... 2×10^5 individualized iPSCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 nuclease +sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... per 5 x 104 hiPSC-CMs using Lipofectamine 3000 transfection agent (Cat. L3000001, ThermoFisher) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... then they were incubated for 2 h in 5% normal donkey serum (NDS, Gibco), 0.2% Triton-X100 in PBS to block nonspecific binding ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections of 4-5 μm were cut using a rotary microtome (HM355S, Thermo Scientific). Sections were deparaffinized in xylene and rehydrated in a descending series of ethanol (96%–50% ...
-
bioRxiv - Cell Biology 2023Quote: ... centrifuged at 1000 rpm for 5 min and washed with 1X cold PBS (Gibco). The resulting pellet was suspended with 1X Annexin binding buffer (Becton Dickinson) ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were blocked in the blocking buffer – 5% BSA (Thermo Fisher Scientific, #BP9704100) in PBST (PBS with 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... Cultures were incubated (37 °C; 5% CO2) in a medium consisting of MEM (Invitrogen), supplemented with 35 mM Glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% FBS and 1% penicillin-streptomycin (all from Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... and cultured at 37°C and 5% CO2 in RPMI 1640 medium (Life Technologies) supplemented with 10% HIFBS (Gibco) ...
-
bioRxiv - Biochemistry 2023Quote: ... for 24 h or 10 nM of siRNA and 5 µL of RNAiMAX (Invitrogen) for 48 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µl were injected using a Vanquish Horizon UPLC (Thermo Fisher Scientific; Waltham, MA) and compounds were separated on a Zorbax Eclipse Plus C18 guard (2.1 × 50 mm and 1.8 μm particle size ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplification was performed on a QuantStudio™5 Real-Time PCR System (ThermoFisher Scientific) using the following cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... Medium was exchanged on DIV 4-5 for phenol-free Neurobasal medium (Thermo Fisher) supplemented with GlutaMAX 1x (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 5 nM of siRNA using Lipofectamine RNAiMAX Reagent (ThermoFisher Scientific) for 72 hours.
-
bioRxiv - Cancer Biology 2023Quote: ... envelope plasmid pIP/VSV-G (5 µg) (ViraPowerTM Lentiviral Packaging Mix, Thermo Fisher Scientific), 5 µg of lentiviral expression construct shRNA (pLKO.1 Mission shRNA DNA clone ...
-
bioRxiv - Biophysics 2023Quote: ... at 37 °C and 5% CO2 in DMEM medium with L-glutamine (ThermoFisher, 11965092) containing 10% FBS (BI ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... B cells were stained with 5 nM CellTrace™ Violet Cell (C34557, Thermo Fisher) for 8 minutes in 37L°C water bath ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 10% FBS (Cytiva HyClone) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 µl of template and TaqMan Fast Virus 1-step mastermix (Applied Biosystems). Primer sequences and concentrations and thermal cycling conditions for SARS-CoV-2 nucleocapsid 1 gene were as previously described (13) ...
-
bioRxiv - Microbiology 2023Quote: ... and either the QuantStudio™ 5 or QuantStudio™ Flex 7 analyser (Applied Biosystems). For analysis on viral gene copy numbers ...
-
Per-pixel unmixing of spectrally overlapping fluorophores using intra-exposure excitation modulationbioRxiv - Biophysics 2023Quote: HeLa cells were grown at 37°C in 5% CO2 atmosphere in DMEM (ThermoFisher) with GlutaMAX-1 complemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 × 105 293T cells were seeded into 48-well plates (Thermo Fisher, CA, USA). After 24 hrs ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured at 37 °C and 5 % CO2 on 4-well plates (Nunc) (300 µl/well ...
-
bioRxiv - Immunology 2023Quote: ... Tumor cell lines were cultured at 37°C and 5% CO2 in DMEM (Gibco) supplemented with 10% FBS (Atlanta Biologicals) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were centrifuged at 800g for 5 minutes and resuspended in PBS (ThermoFisher Scientific) with 2% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were centrifuged for 5 min at 300 g and washed with PBS (Gibco) supplemented with 4% FCS and DNase I (LIFE Technologies) ...
-
bioRxiv - Immunology 2023Quote: All cell lines were cultured at 37 °C and 5% CO2 in DMEM (GIBCO) supplemented with 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Cancer Biology 2023Quote: ... RS4-11 were cultured at 37°C with 5% CO2 in IMDM (ThermoFisher, 12440053) supplemented with 10% v/v heat-inactivated fetal bovine serum (HI-FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were blocked with 5% normal goat serum (NGS) (Thermofisher Scientific, Cat# 31872) for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 10% FBS (Cytiva HyClone) ...
-
bioRxiv - Neuroscience 2023Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (Thermo Fisher Scientific, 90115) for 15 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) using PowerTrack SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µL of 10% w/v ammonium persulfate (APS; ThermoFisher Cat. No. 17874) were added to 90 µL of monomer solution and briefly vortexed ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... synchronized HCFs were harvested and stained with 5 µM CellTrace™ CFSE (C34570, Invitrogen) in PBS for 20 min at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco). All cells were cultured at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... incubated for 1 hour in blocking solution containing Hoechst 33342 (Invitrogen; 5 µg/ml) and secondary antibodies labeled with AlexaFluor 488 or AlexaFluor 555 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... cells were labeled with 5 μM carboxyfluorescein succinimidyl ester (CFSE; Life Technologies; Cat # C34554). For Day 2 studies ...
-
bioRxiv - Immunology 2023Quote: ... 5% CO2 in RPMI containing 10% heat-inactivated fetal bovine serum (Gibco, Gaithersburg, MD) with 1% Penicillin Streptomycin (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were performed using a QuantStudio-5 Real-Time PCR machine (Applied Biosystems) and analysed using QuantStudio Design and Analysis Software v1.5.2 (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... we added 5 μl of TURBOTM DNase (Invitrogen by Thermo Fisher Scientific; Cat #AM2238) and 10 μl of 10ξ Turbo DNase buffer to degrade the remaining DNA at 37°C for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: Cell proliferation assays were conducted employing 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Cat# C10337), a thymidine analog ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μg of each construct was diluted into 250 μL OptiMEM (Thermo Fisher Scientific) and mixed with 250 μL OptiMEM containing 20 μg of polyethylenimine (PEI – maximum molecular mass of 40,000 Da ...
-
bioRxiv - Biochemistry 2023Quote: ... washed 5-10x with sterile HBSS-HEPES and digested with 0.25% trypsin (Gibco 15050065) supplemented with 80 Kunits of DNAseI (Sigma DN25 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 5 ug of Dextran Alexa 555 were added into nuclease-free water (Invitrogen) to make 10 ul of mixture ...