Labshake search
Citations for Thermo Fisher :
5251 - 5300 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using QuantStudio Pro real-time PCR system with Power Track SYBR Green Master Mix reagents (Applied Biosystems).
-
bioRxiv - Plant Biology 2022Quote: ... and qPCR was performed in 10 μl reactions using qPCRBIO SyGreen Mix (PCR Biosystems) with a StepOnePlus Real-time PCR system (Applied Biosystems). For verifying transgene induction ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to the manufacturer’s instructions with qRT-PCR performed using SYBR Green Master Mix (SparkJade) using a StepOnePlus™ real-time PCR intrument (ThermoFisher). Fat1 levels were measured using forward (5′ GGACCAGCATCGCAAGAGTC 3′ ...
-
bioRxiv - Neuroscience 2024Quote: ... TBP forward 5’-CCT GTT CAG AAC ACC AAT AGT TTA–3’ and reverse 5’–GTG GAT ACA ATA TTT TGG AGC TGT–3’ Real Time–PCR (qRT–PCR) was performed using PowerUp SybrGreen master mix (Applied Biosystems), using 0.25 μM each primer and 5–15 ng cDNA for each reaction in triplicate ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR was conducted using ChamQ SYBR qPCR Master Mix (Vazyme, Q311) on an ABI StepOnePlus real-time PCR system (Applied Biosystems). Expression values were normalized using the ΔΔCt method with Gapdh as the internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was obtained by reverse transcription using the M-MLV Reverse transcriptase and quantitative PCR was performed in technical triplicates on a Quant Studio 5 Real-Time PCR System (Applied Biosystems) using iTaq Univeral SYBR Green Supermix (Biorad ...
-
bioRxiv - Genomics 2024Quote: ... was performed using Power SybrGreen PCR master mix on a ViiA 7 real-time PCR system using standard settings (Applied Biosystems). Expression of genes was normalised to two housekeeping genes (Bactin ...
-
bioRxiv - Biochemistry 2024Quote: The expression of different target genes was validated by quantitative PCR (qPCR) using the 7500 Real-Time PCR Systems (Applied Biosystems). The reactions were performed with the Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using standard SYBR green reagents and protocols on a QuantStudio 7 Real-Time PCR system (Applied Biosystems). All reactions were performed in technical triplicates ...
-
bioRxiv - Cancer Biology 2024Quote: ... Analysis of gene expression was performed with the Applied Biosystems 7500 Real-Time PCR System using SYBR Green PCR Master Mix (Applied Biosystems) according to standard protocols ...
-
bioRxiv - Immunology 2022Quote: ... cDNAs obtained were diluted and quantitative PCR was performed using the PerfeCTa SYBR Green FastMix (Quantabio) on a QuantStudio 3 Real-Time PCR System machine (Applied Biosystems). Standard cycling was used (45 cycles of 95 ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using TaqMan Assay-on-Demand primer sets (Applied Biosystems by Thermo Fisher Scientific) or Power SYBR Green PCR Master Mix (Merck) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR analysis was performed with 2×Realab Green PCR Fast mixture (Lablead, China) in a StepOnePlus real-time PCR instrument (Applied Biosystems). OsActin was used as an internal control gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The expression levels of selected genes were determined using qRT-PCR (QuantStudio 6, ThemoFisher Scientific) using the SYBR Green Real-time PCR master mix (Thermo Scientific). The sequence of the primers used for the gene expression analysis was given in an appendix.
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR reactions were performed in duplicates including non-template controls on a QuantStudio 3 Real-Time PCR system (Applied Biosystems). Expression levels of analyzed genes relative to a reference gene (ACTB or Actb ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time RT-PCR analysis was performed using SYBR Green Realtime PCR Master Mix (Toyobo) with the Applied Biosystems Step Two Real-Time PCR System (Applied Biosystems). GAPDH was used as a control ...
-
bioRxiv - Cancer Biology 2023Quote: ... TaqMan Universal PCR Master Mix or Power SYBR Green PCR Master Mix (Applied Biosciences) were used to amplify transcripts using QuantStudio3 Pro Real-Time PCR System (Applied Biosystems). Relative expression of target genes was measured comparing against housekeeping controls β-actin or Ef1a.
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR was performed with triplicates in 96-well plate format on the QuantStudio 3 Real-Time PCR system (ThermoFisher Scientific). HORMAD1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The abundance of mRNA was measured by quantitative real-time PCR analysis using the SYBR Green PCR Master mix (Applied Biosystems). PCR was carried out with 96-well plate using Applied Biosystems 7500 Real-Time PCR Systems ...
-
bioRxiv - Microbiology 2023Quote: Real-time PCR was performed by standard TaqMan Assay on either the QuantStudio 7 or Quantstudio 5 Real-Time PCR platform (Applied Biosystems). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA product was further diluted 1:4 in nuclease-free water and 2 μl were used in a 15 μl total reaction for qRT-PCR (7500 Fast Real-Time PCR instrument; Applied Biosystems), using SYBR green as nucleic acid stain (Roche 4913850001) ...
-
bioRxiv - Immunology 2023Quote: ... DNA products were used for real time qRT-PCR reaction using the TaqMan 2X Universal PCR Master Mix (Thermo Fisher Scientific) on an iQ5 RT-PCR detection system (BioRad ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system; Applied Biosystems, Foster City, CA, USA). PCR was performed with 30 to 40 cycles (94°C for 30 s ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using TaqMan Assay-on-Demand primer sets (Applied Biosystems by Thermo Fisher Scientific) or Power SYBR Green PCR Master Mix (Merck) ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT PCR was performed as described previously (Li et al, 2018) using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). SsoFast EvaGreen Supermixe (Takara ...
-
bioRxiv - Genomics 2023Quote: ... The expression of mRNA was examined by quantitative PCR analysis using a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). TaqMan assays were used to quantitate ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR was performed using a Viaa7 Real Time PCR instrument (Applied Biosciences) using TaqMan Universal PCR master mix II - UNG (Thermo Fisher). Primers for RT-qPCR are described in Supplementary Data S3.
-
bioRxiv - Immunology 2023Quote: ... The concentration of libraries was measured by an ABI PRISM 7500 Real-time PCR system in combination with a Power SYBR Green PCR Master Mix (Thermo Fisher). Single-end sequencing of cDNA libraries with a read length of 51 was performed with HiSeq 1500 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Relative quantitation of mRNAs was carried out via SYBR green-based quantitative PCR using a Quantstudio 3 Real-time PCR system (Applied Biosystems). PCR results were analyzed using the 2-(ΔΔCT ...
-
bioRxiv - Cell Biology 2023Quote: ... Taqman-based quantitative real time PCR was performed using the SuperScript III Platinum One-Step qRT-PCR reagent (Thermo Fisher #11732088). 20 ng RNA was loaded per reaction in a 10 μL volume ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed in triplicate using PerfeCTa SYBR Green FastMix (Quantabio) and a QuantStudio 5 Real-Time PCR machine (Applied Biosystems), and the results were computed relative to a standard curve made with cDNA pooled from all samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 ng of digested/undigested DNA was then quantified by real time PCR using a 7500 FAST Applied Biosystems thermocycler with SYBR Green PCR Master Mix (Applied Biosystems) and 100 nM of primer in a 20 μl reaction ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 µL was used as template for quantitative PCR (qPCR) using PowerUp SYBR green master mix (Applied Biosciences) on a ViiA7 real-time PCR machine (Applied Biosystems), following the manufacturer’s suggested protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... and RT-PCR (Invitrogen; 18064014), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR (Applied Biosystems) was performed on cDNA samples for Ccl19 ...
-
bioRxiv - Cancer Biology 2024Quote: ... miR-scrambled and anti-miR-scrambled obtained from Invitrogen™ mirVana™ (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR was performed using the Power SYBR Green PCR Master Mix Kit (Applied Biosystems) on a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Pathology 2019Quote: ... SYBR® Green PCR Master Mix and RT-PCR Reagents kit (Applied Biosystems, Foster city, USA) were used to do real time PCR on an ABI 7500 FAST REAL TIME PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative RT-PCR was performed with a SuperScript III Platinum One-Step qRT-PCR Kit (Thermofisher) in a CFX96 Touch Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed with the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen) using a Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2019Quote: ... Quantitative RT-PCR was performed using the ABI PRISM 7900 sequencing detection system (Applied Biosystems, Foster City, CA, USA) with SYBR green master mix under the following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was quantified by RT-qPCR with the AgPath-ID One Step RT-PCR KIT (Thermo Fisher), using the forward primer 5’ - ATC TGA CAA CGG AAG GTG GG – 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Paris using Ag Path-ID One-Step RT-PCR kit® (Thermofisher). PCR reaction was run on the ABI PRISM® 7900 system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was performed with the Superscript III RT-PCR Kit (Invitrogen). Quantitative PCR was performed with the SYBR Green PCR Master Mix using the ABI StepOnePlus Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... One-Step RT-PCR SuperScript™ III Platinum™ Kit (Life Technologies) was used for virus detection ...
-
bioRxiv - Microbiology 2021Quote: ... Using a SuperScript III One-Step RT–PCR kit (Thermo Fisher Scientific), the RT-PCR product (596 bp ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed using the SuperScript III Reverse Transcriptase kit (ThermoFisher) with oligo(dT)20 primer.
-
bioRxiv - Neuroscience 2022Quote: ... 2μg of cDNA prepared using a 2-step RT-PCR kit (Invitrogen) was used in 28 cycles of PCR with PlatinumTaq (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR was performed using the PowerUP SYBR Green Kit (Thermo Fisher) and the QuantStudio 5 Real-Time PCR Detection System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... using the AgPath-ID One-Step RT-PCR kit (Thermo Fisher Scientific) with target-specific primers ...