Labshake search
Citations for Thermo Fisher :
5151 - 5200 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... all used viruses were propagated to passage 3 on Calu-3 (ATCC HTB-55) cells in Advanced DMEM/F12 (Gibco), supplemented with HEPES ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2023Quote: ... and loaded with the Fluorescent Dye-Based Rhod-3 AM following the manufactures’ instructions (Rhod-3 Calcium Imaging Kit, Cat.No. R10145; ThermoFisher scientific). Loading ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5040 amperometric cell and a Hypersil Gold C18 analytical column (3 μm, 100 × 3 mm; Thermo Fisher Scientific, USA). The mobile phase consisted of 0.1 M KH2PO4 buffer at pH 3.8 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... A single-cell suspension from PBMC from each patient was quantified and analyzed for viability using the Cell counter 3 (Countess 3, Invitrogen) and then loaded onto the 10X Genomics Chromium Single Cell Controller for isolation of single cells (10X Genomics) ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Biophysics 2020Quote: ... Poly-L-Lysine-coated (PLL-coated) glass slides from Thermo Scientific™ (J2800AMNZ ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cells were cultured in RPMI 1640 with L-glutamine (Gibco), 10% (v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 4 mM L-Glutamine (Glutamax™, Gibco, Life Technologies), 10% fetal calf serum (FCS ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 4 mM L-Glutamine (Glutamax™, Gibco, Life Technologies), 10% fetal calf serum (FCS ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1% (v/v) L-Glut (GlutaMAX supplement) (Gibco, Catalog No. 35050038) and 1% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-rabbit Alexa 568 IgG (H+L) (1:100; Invitrogen), goat anti-mouse Atto 647N (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-Chicken IgY (H+L) Alexa-488 (Thermofisher A-11039) (dilution 1:500) ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor® 488 Goat-anti-Rabbit IgG (H+L) (Invitrogen), Alexa Fluor® 594 Goat-anti-Mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... and laminin (0.2 mg/L, Thermo Fisher Scientific Cat# 23017–015) were added in N2 medium for the first 2 days ...
-
bioRxiv - Neuroscience 2021Quote: ... Goat anti-Mouse IgG (H+L) HRP (1:2000; Invitrogen, A16066), Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2019Quote: ... and 0.1 µg of pcDNA-L using Lipo3000 transfection reagent (Invitrogen) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... and an additional 1% L-Glutamine (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2020Quote: ... the medium was changed to Leibovitz’s L-15 (Thermo Fisher Scientific), Ringer’s solution (138 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... Alexa Fluor 488 goat anti-rat IgG(H+L) (Life Technologies) were added (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... Alexa Fluor 568 donkey anti-rabbit IgG (H+L) (Thermo Fisher Scientific Cat#A10042 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2mM L-Glutamine and 1% penicillin/streptomycin solution (Life Technologies, Belgium) in an incubator set at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... 100U/mL Penicillin/streptomycin and 2mM L-glutamine (Gibco, Thermo-Fisher). For siRNA knockdown ...
-
bioRxiv - Immunology 2021Quote: ... and 1% (v/v) L-glutamine (2 mM final concentration, Gibco). Cells were maintained at 37°C (5% CO2) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1% (vol/vol) L-glutamine (Life Technologies Australia, 25030-081) as previously described45 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2mM L-glutamine (1X Gibco® GlutaMAX™ Supplement, 35050061) at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2019Quote: ... 1 mM sodium pyruvate and 2 mM L-Glutamine (Thermo Fisher) to a final cell density of 1 × 107 cells per ml ...
-
bioRxiv - Microbiology 2019Quote: ... in Leibovitz medium (Gibco™ Leibovitz’s L-15 Medium, Life Technologies) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2019Quote: ... and goat anti-rat IgG (H+L) (AF680) (Thermofisher, A-21096).
-
bioRxiv - Microbiology 2019Quote: ... supplemented to 5% FBS (Sigma-Aldrich, and 2mM L-glutamine (Invitrogen).
-
bioRxiv - Neuroscience 2019Quote: μL of anti-HA magnetic beads (Thermo Fisher Scientific, Cat #88836) and rotated end-over-end overnight at 4°C ...