Labshake search
Citations for Thermo Fisher :
5101 - 5150 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3′-ligated RNA fragments and subtracted 3′-ligated RPF fragments were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) at 48 °C for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
bioRxiv - Cancer Biology 2024Quote: ... was injected into buccal mucosa of tumor-bearing KOG mice 3 times every 3 days along with 100 μg polyI:C (Invitrogen) as adjuvant.
-
bioRxiv - Neuroscience 2020Quote: ... Alexa Fluor® 488 goat anti-rabbit IgG (H+L) and Alexa Fluor® 555 goat anti-rabbit IgG (H+L) (Life Technologies, Carlsbad, California, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Immunology 2021Quote: ... iBMDMs were incubated for 3 h in 50 μM of the mitochondrial uncoupler carbonyl cyanide 3-chlorophenylhydrazone (CCCP; ThermoFisher, M20036). Control samples included ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... supplemented with 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine (DiI)-labelled acetylated-LDL (15µg/ml, Thermo Fischer) or DiI-labelled LDL (15 µg/ml, Thermo Fisher) and incubated at 37°C for 2 hours ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Systems Biology 2021Quote: ... The Caspase-3 assay was performed on retina sections following the protocol described above (anti-caspase 3 (Fisher Scientific, 15889738) 1:500) ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA biotinylation at the 3′ end was performed using the Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific, US) in accordance with the manufacturer’s instructions with some modifications ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biophysics 2022Quote: ... Texas Red-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanloamine (TR-DHPE) and Oregon Green-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (OG-DHPE) were purchased from Thermo Fisher. PLL-PEG and PLL-PEG-biotin were purchased from SuSoS AG ...
-
bioRxiv - Biophysics 2022Quote: ... Cryo-EM grids were imaged using SerialEM44 with a 3×3 image shift collection (with calibrated correction for image shift induced beam tilt) on a Titan Krios (ThermoFisher) equipped with a K3 camera and a Bioquantum energy filter (Gatan ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Genomics 2019Quote: ... The 3’ end of the Ppetra cDNAs were determined with the 3 RACE System for Rapid Amplification of cDNA Ends (Invitrogen); the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 25 μl/well of 60 mM water solution of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Thermo Fisher Scientific) were added ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was end labelled at the 3’ end with biotin using the Pierce RNA 3’ End Biotinylation Kit (Thermo Fisher). RNA quantity was assayed by running an RNA 6000 Nano chip on a 2100 Bioanalyzer ...
-
bioRxiv - Cancer Biology 2020Quote: mRNA associated with 1 to 3 ribosomes “Light polysomes” and mRNA associated with more than 3 ribosomes “Heavy polysomes” were extracted using TRIzol LS (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Molecular Biology 2019Quote: ... or for pre- and mature mRNAs (far-3, ZK970.7) or for pre-mRNA only (eft-3) and using StepOnePlus Real-time PCR Systems (Applied Biosystems) according to the suppliers’ protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lipophilic dye DiL (DilC18(3) (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate) at 1mM stock in ethanol (Invitrogen; Carlsbad, CA, USA) was used to label nanoparticles to observe in vitro delivery ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...