Labshake search
Citations for Thermo Fisher :
5051 - 5100 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The last injection added 0.2 μg/ml Hoechst (Life Technologies, cat. n. 33342-Invitrogen™) used for cell counting ...
-
bioRxiv - Microbiology 2020Quote: ... and 50 units/mL penicillin and 50 µg/mL streptomycin (Gibco; cat n° 5070-063). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2 and passaged at an 1:8 ratio every 4 days.
-
bioRxiv - Microbiology 2021Quote: ... Cells were stained with mouse anti-SARS-CoV-2 N (#MA5-29981; Thermo Fisher Scientific) and anti-mouse IgG Alexa488 (#A-11029 ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 50 mg CG was dissolved in pyridine and 150 mg N-Ac-Sulfa (Acros Organics) reagent was added ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 40 mg AG was dissolved in pyridine and 80 mg N-Ac-Sulfa (Acros Organics) reagent was added ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse monoclonal antibody generated against the C-terminal domain of N-cadherin (Invitrogen; 1:500); anti-CRB1 (a kind gift of Dr ...
-
bioRxiv - Cell Biology 2019Quote: Flasks used for hPSC maintenance were coated with vitronectin (VTN-N) (Cat. # A14700, Life Technologies) diluted to 5 µg/ml in Dulbecco’s phosphate buffered saline (PBS ...
-
bioRxiv - Physiology 2021Quote: ... EZ-Link N-hydroxysuccinimide-SS-biotin (#21331) and streptavidin-Sepharose beads (#20357) (Thermo Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by the addition of 25 mM N-ethylmaleimide (NEM) (Thermo Scientific, Rockford, IL USA) for 20 min at 37°C ...
-
bioRxiv - Immunology 2020Quote: Cell culture supernatant (diluted ¼) was subjected to ELISA (TNFα, Thermo Scientific, Waltham, MA, n=6) and Luminex (Cytokine Human Magnetic 30 Plex Panel ...
-
bioRxiv - Cell Biology 2021Quote: ... Actin was additionally labelled on Cys 374 using either N-(1-pyrene)-iodoacetamide (Life Technologies), or tetramethylrhodamine-5-maleimide (Adipogen Life Sciences)(Criddle et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... which are pre-treated with 0.1 N sodium hydroxide (cat. SS255-1, Fisher Scientific, IL), 0.5% 3-aminopropyltrimethoxysilane (cat no ...
-
bioRxiv - Biochemistry 2022Quote: ... each with an N-terminal (His)6 tag from plasmids generated by GeneArt (ThermoFisher Scientific). For each purification ...
-
bioRxiv - Genomics 2022Quote: ... The fixed tissue was blocked using 100 mM N-succinimidyl (acetylthio) acetate (NHS-acetate; ThermoFisher) diluted in NHS-acetate buffer (0.1M NaP+0.1% Tween PH8 in DEPC H2O ...
-
bioRxiv - Neuroscience 2024Quote: Frozen tissues were homogenized in ice-cold N-PER Neuronal Protein Extraction Reagent (Thermo Fisher) containing protease inhibitor and phosphatase inhibitor cocktail (Cat# PPC1010 ...
-
bioRxiv - Cell Biology 2023Quote: ... Enriched N-terminal peptides were then desalted with a C18 spin column (Thermo Fisher Scientific) and the eluate fraction was freeze-dried ...
-
bioRxiv - Cell Biology 2023Quote: N/TERT-2G keratinocytes were electroporated using the NEON transfection system 10µL kit (ThermoFisher Scientific). N/TERT-2G keratinocytes were detached from culture plastic and washed twice with dPBS (without Ca2+ and Mg2+ ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.1% Triton X–100 and 400 μM Maleimidobenzoyl–N–hydroxy succinimide ester (ThermoFisher Scientific, 22311), washed two times with 1x Phosphate–buffered saline (PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Some N-terminal deletion mutations were cloned by PCR using Phusion Polymerase (Thermo Fisher Scientific) followed by ligation using T4 DNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and 50 units/ml penicillin and 50 μg/ml streptomycin (Gibco; cat n° 5070-063). Cells were cultured at 37 °C in a 5% CO2 gas-equilibrated humidified incubator and passaged every 3-4 days.
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in GlutaMAX containing Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, cat n° 31966-047) supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... SK-N-AS cells were cultured in Iscove′s Modified Dulbecco′s medium (IMDM; Thermofisher) with 20% FBS (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... and plated in the fibroblast medium onto truncated recombinant human vitronectin (VTN-N, Gibco, A14700)-coated plates ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded in a 4-chamber glass bottom dish (D35C4-20-1-N, Invitrogen) for confocal imaging or in a 60 mm × 15 mm dish (705001 ...
-
bioRxiv - Biophysics 2023Quote: ... The slides were then incubated for 5 min in 0.1 N HCl (Fisher Scientific; S25354) and washed with 2xSSC (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was then degraded by the addition of 1.5 µL 1 N NaOH (Fisher Scientific) and incubation at 70 °C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 µg/mL fibronectin in DMEM F12 with 1 % N-2 supplement (Invitrogen #17502048), 1 % L-Glutamine (Biological Industries #03-020-1B) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfection into cultured SK-N-AS cells was performed using Lipofectamine 2000 (Thermo Fisher Scientific) following standard protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... Pyrenyl-actin was made by labelling actin with N(1-pyrene)-iodoacetamide (Thermo Fisher Scientific) (Cooper et al ...
-
bioRxiv - Microbiology 2024Quote: ... N sgRNA was detected using TaqMan™ Universal PCR Master Mix (Applied Biosystems – cat # 4304437) and each reaction contain ...
-
bioRxiv - Cell Biology 2020Quote: ... Endoplasmic reticulum (ER) was labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, aka DiIC18(3)) (Thermo Fisher #D282) or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Biochemistry 2020Quote: Cultivated Jurkat cells were collected and washed 3 times in flow buffer (PBS without Ca/Mg, 3% FBS, Gibco). Cell concentration was measured ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were run on the QuantStudio 3 and analyzed on the QuantStudio 3 Design and Analysis software v1.5.1 (ThermoFisher Scientific). Quantitation and normalization of relative gene expression were accomplished using comparative threshold cycle method or ΔΔCT.
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then lysed and a caspase-3 assay was performed according to the manufacturer’s protocol (EnzChek caspase-3 Assay, Invitrogen). The intensity of fluorescence was analyzed using an EnVizion plate reader.
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting VH-(G4S)3-VL ScFv fragment was further fused at the N-terminus of the murine TNF gene through a S4G-linker and the final construct VH-(G4S)3-VL-(S4G)3-TNF was then cloned into the mammalian expression vector pcDNA3.1 (+) vector (Invitrogen). A VH-(G4S)3-VL ScFv fragment specific for hen egg lysozyme (KSF)(34) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cancer Biology 2024Quote: Total mRNA from 3 CT-PAK2EC and 3 KO-PAK2EC average-sized tumors was extracted using TRIZOL reagent (Invitrogen) according to recommended procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...