Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmids (1 μg of guide RNAs +/- 3 μg donor) were diluted in 1 ml OptiMem (Gibco) and 20 ul PEI (1 mg/ml) ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 1/10 volume of 3 M sodium acetate and 1 μL glycogen 10 mg/mL (Thermofisher). Pellet obtained by centrifugation 15000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... mIMCD-3 cells were cultured in 1:1 DMEM high-glucose pyruvate (41966052, GIBCO, Life Technologies): F-12 Nutrient Mixture (21765037 ...
-
bioRxiv - Cell Biology 2024Quote: ... mIMCD-3 cells were cultured in 1:1 DMEM high-glucose pyruvate (41966052, GIBCO, Life Technologies): F-12 Nutrient Mixture (21765037 ...
-
bioRxiv - Biophysics 2021Quote: ... 1 µM of TO-PRO-3 iodide (Thermo Fisher, T3605) was added for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-CENP-A (Clone 3-19, Invitrogen; 1:1000 dilution) and anti-“Bonsai”/NDC80 (68 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-Lamin B2 (mouse, Invitrogen, clone E-3, 1:500), anti-EEA1 (mouse ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μg mL−1 Cascade Blue (3 kDa, Thermo Fisher) was added to the antibiotic-free expansion media in the top epithelial channel with a flow rate of 30 μL hr−1 ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was diluted 1:3 in nuclease-free water (Ambion) and added to 5 μL SyGreen HiROX mix (PCR Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-Galectin-3 (1:200, Invitrogen, 14-5301-82); rabbit anti-Fibronectin (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... or Toto-3 iodide (T3604, Invitrogen, MA, USA; 1:500) diluted in PBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were counterstained with TO-PRO-3 (1:5,000, Invitrogen) together with secondary antibodies when necessary ...
-
bioRxiv - Microbiology 2020Quote: 1 μL of random primers at 3 μg/μL (Invitrogen) were added to fragmented RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... nuclei were stained with 1 µg/mL TOTO-3 (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Transfection was performed using 1:3 DNA: Lipofectamine 2000 (Invitrogen) ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-INSR (1:50, clone CT-3, Invitrogen, AHR0271).
-
bioRxiv - Immunology 2021Quote: ... either with 1 μM FluoZin-3-AM (Thermo Fisher scientific) at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... with a 1:3 ratio of siRNA:RNAiMax (Thermo Fisher Scientific). 48 hours post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... All lines were maintained in 3:1 DMEM (Gibco, 11960044): F12 media (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: 1” x 3” glass microscope slides (12-550-A3, ThermoFisher) were cleaned with 0.1% Triton X-100 (T9284 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at 3:1 bead:cell ratio in AIM-V media (Gibco) supplemented with 5% FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... in HBSS and 1 μM YOYO-3 iodide (Thermofisher, Y3606) in the culture media ...
-
bioRxiv - Biochemistry 2023Quote: ... 3-Isobutyl-1-methylxanthine (IBMX) was from Acros Organics (#228420050). PF-04447943 was purchased from MedChem Express (#HY-15441/CS-0942) ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-Adenylate Cyclase 3 (IF: 1:500, Invitrogen, PA5-35382); Anti-Ephrin-B1 (IF ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were diluted (1:3) using loading buffer (ThermoFisher), heat-denatured for 3 minutes at 95°C ...
-
bioRxiv - Immunology 2024Quote: ... at a mass ratio of 1:3 in OptiMEM (ThermoFisher). After incubating for 25 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020) ...