Labshake search
Citations for Beckman :
1 - 50 of 422 citations for SARS CoV 2 Spike Glycoprotein S2 aa 800 1000 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Single-cell clones were then assessed for binding to His-tagged SARS-CoV-2 Spike using a Cytoflex S (Beckman) cell analyser ...
-
bioRxiv - Immunology 2022Quote: CD27+ IgM- B cells cross-binding to SARS-CoV-1 and SARS-CoV-2 RBD were sorted from SARS-CoV-2 vaccinated SARS convalescents with MoFlo Astrios EQ Cell Sorter (Beckman Coulter). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... Access SARS-CoV-2 IgG (Beckman Coulter), and LIAISON SARS-CoV-2 S1/S2 IgG (DiaSorin) ...
-
bioRxiv - Immunology 2021Quote: The ACCESS SARS-CoV-2 CLIA (Beckman Coulter Inc., California, USA) was used for semiquantitative detection of IgG directed against S protein RBD using serum obtained from venipuncture blood ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 RBD+ were sorted with MoFlo Astrios EQ Cell Sorter (Beckman Coulter).
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 RBD+ were sorted with MoFlo Astrios EQ Cell Sorter (Beckman Coulter). FACS data were analyzed using FlowJo™ v10.8 (BD Biosciences).
-
bioRxiv - Immunology 2021Quote: ... Beckman Coulter Access SARS-CoV-2 IgG assays (Brea, CA, USA) targeting the RBD were performed on UniCel DxI 800 Access Immunoassay System (Beckman Coulter). Index value threshold for positivity was 1 as recommended ...
-
bioRxiv - Microbiology 2021Quote: ... UV-Vis spectra (200-800 nm) were recorded using a spectrophotometer (Beckman Coulter DU 800) for solutions containing pure TOX (100 ...
-
bioRxiv - Immunology 2020Quote: ... KIR2DL2/S2/L3 (GL183, PE-Cy5.5, Beckman Coulter), KIR2DL1/S1 (EB6 ...
-
bioRxiv - Immunology 2020Quote: ... KIR2DL2/3/S2 (GL183, PE/Cy5.5, Beckman Coulter,), NKG2C (134591 ...
-
bioRxiv - Immunology 2023Quote: ... KIR2DL2/L3/S2 (PE, clone GL183, Beckman Coulter, IM2278U), KIR2DL1 (PE or APC ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 lentiviral pseudotyped neutralization assays were performed on integrated automation platforms consisting of a Biomek liquid handler from Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... The Immuno-turbidimetric method (Beckman Coulter DXI 800) was used to assay serum high sensitivity C-reactive protein (CRP ...
-
bioRxiv - Microbiology 2024Quote: ... A Beckman Coulter DU 800 spectrophotometer (Beckman Coulter) was used to monitored substrate hydrolysis ...
-
bioRxiv - Neuroscience 2020Quote: ... DRG were then centrifuged for 2 min at 1000 rpm (Beckman Allegra X15R, 233xg), supernatant aspirated ...
-
bioRxiv - Genetics 2022Quote: Luminescence of transfected S2 cells were measured using a liquid scintillation counter LS6000IC (Beckman) in single-photon collection mode ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... Total serum IgE was quantified by IMMAGE® 800 (Beckman Coulter) performed at LRC Hamilton for a general measure of atopy ...
-
bioRxiv - Bioengineering 2022Quote: ... Absorbance spectra were recorded with a DU-800 UV-visible spectrophotometer (Beckman). The fluorescence spectra were measured using a Safire2 microplate reader (Tecan).
-
bioRxiv - Cell Biology 2020Quote: ... spinning at 3,200 rpm (Beckman J-6M/E centrifuge). The centrifuge chamber was set at 4°C during all centrifugation steps until approximately 10 min before cell harvesting ...
-
bioRxiv - Physiology 2020Quote: ... one bird per pen in Experiment 2) and centrifuged for 5 min at 17013 × g using a Beckman microfuge (Model E 348720, Beckman Instruments, INC, Palo Alto, CA). Then the viscosity of ileal supernatant was measured using a Brookfield cone-plate digital viscometer (Model LVDV-Ⅲ ...
-
bioRxiv - Microbiology 2019Quote: ... The luminescence was measured using a DTX-800 multimode plate reader (Beckman Coulter). Standard curves were generated using serial dilutions of standard GSH (provided by the kit ...
-
bioRxiv - Microbiology 2020Quote: ... Luciferase activity was measured on a DTX-800 multimode plate reader (Beckman Coulter) using Luciferase Assay Reagent (Promega E4550) ...
-
bioRxiv - Biophysics 2019Quote: ... Absorption spectra were recorded with a DU 800 spectrophotometer (Beckman Coulter, Brea, CA). Sub-micro fluorometer cuvettes (100 μL Starna ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The absorbance spectra were acquired with a DU-800 UV-vis spectrophotometer (Beckman). The fluorescence spectra were acquired with a Safire2 plate reader (Tecan ...
-
bioRxiv - Neuroscience 2020Quote: ... while absorbance measurements were collected on a DU-800 UV-Visible Spectrophotometer (Beckman).
-
bioRxiv - Cancer Biology 2021Quote: ... The relative activity of Caspase was determined with a spectrophotometer (DU-800, BECKMAN, USA) at 405 nm (31).
-
bioRxiv - Microbiology 2022Quote: ... Culture densities were recorded in 5x dilution at 500 nm (Beckman Coulter DU 800). Strains were grown in biological duplicate and each supernatant was assayed in technical duplicate ...
-
bioRxiv - Pathology 2023Quote: ... and the bacterial growth was monitored using a spectrophotometer (Beckman Coulter, Model DU 800).
-
bioRxiv - Microbiology 2024Quote: ... The OD600 of the culture was measured using a spectrophometer (Beckman Coulter, DU-800) over the course of 24 hrs ...
-
bioRxiv - Genomics 2021Quote: Beckman Coulter Avanti J-E centrifuge (Beckman Coulter, cat, no. A20698)
-
bioRxiv - Genomics 2019Quote: ... the Hi-C libraries were purified with AMPure XP beads (Beckman Coulter). The concentration of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the Hi-C libraries were purified with AMPure XP beads (Beckman Coulter). Quantity and integrity of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies).
-
bioRxiv - Biophysics 2020Quote: ... The solution concentration was determined by absorbance measurement using a Du 800 spectrophotometer (Beckman Coulter) and extinction coefficient ε = 0.763 mL * mg−1 * cm−1 at 280 nm4,6.
-
bioRxiv - Biochemistry 2020Quote: ... All were measured by using the UniCel DxI 800 immunochemistry analyzer (Beckman Coulter Inc., USA) according to manufacturer’s assay instructions and requirements ...
-
bioRxiv - Microbiology 2021Quote: ... and then measured at 595 nm using a UV/Vis Spectrophotometer (Beckman Coulter DU-800). The biofilm biomass was quantified as A595/cm2 by the CV staining method ...
-
bioRxiv - Molecular Biology 2021Quote: ... UniCel® DxC 600/800 System(s) and Synchron® Systems Multi Calibrator (Beckman Coulter), according to the manufacturer’s instructions at the Zurich Integrative Rodent Physiology (ZIRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified fragments were size selected (150 bp-800 bp) using SPRIselect beads (Beckman Coulter, #B23318). Analysis of library quality was done with Agilent 2100 Bioanalyzer using High Sensitivity DNA Analysis kit (Agilent ...
-
bioRxiv - Microbiology 2023Quote: In-vivo absorption spectra were obtained using a Beckman DU 800 spectrophotometer (Beckman Coulter Inc.) in absorbance scan mode from 400 to 700 nm at 1.0 nm intervals and a scan speed of 1200 nm/min and Pro99 medium was used for blank measurements.
-
bioRxiv - Developmental Biology 2024Quote: ... individual libraries were size selected (100–800 bp) with Ampure XP beads (Beckman Coulter, #A63881). Libraries were quantified using the Qubit Fluorometer (dsDNA High Sensitivity Kit ...
-
bioRxiv - Genetics 2019Quote: ... and sex hormone binding globulin (SHBG) were determined by a chemiluminescent immunoassay (Beckman Coulter DXI 800). The Immuno-turbidimetric method (Beckman Coulter DXI 800 ...
-
bioRxiv - Neuroscience 2020Quote: ... and measured by two step competitive analysis on a Unicel DXI 800 Access Immunoassay System (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2019Quote: CE experiments were performed on a PA 800 plus CE system (Beckman Coulter, Fullerton, CA, USA) equipped with a LIF detector ...
-
bioRxiv - Microbiology 2023Quote: Bacteria growth in monocultures was estimated spectrophotometrically in term of OD600 evolution (DU 800, Beckman Coulter). In cocultures ...
-
bioRxiv - Cell Biology 2019Quote: ... and spun for 1 hour in a MAX-E tabletop ultracentrifuge (Beckman) at 4°C and 100,000 × g (47,000 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysed cells were pelleted via centrifugation (Beckman Coulter, Avanti J-E) at 40,000 × g for 35 min ...
-
bioRxiv - Genetics 2019Quote: ... The Hi-C libraries were purified with AMPure XP beads (Beckman Coulter, A63881) and sequenced using an Illumina sequencing platform.
-
bioRxiv - Immunology 2019Quote: ... Serum concentrations of hs-CRP and fibrinogen were determined in CatLab through nephelometry (Beckman Coulter Immage 800) and PT-derived fibrinogen (FIBPT ...
-
bioRxiv - Biochemistry 2021Quote: Cell free BAL was weighed (=400-800 µL) and ultra-centrifuged (J2-MC, Beckman Coulter, Krefeld, Germany) for 1h at 4°C at 38.730 g ...
-
bioRxiv - Cell Biology 2023Quote: ... Urine and blood parameters were measured using UniCel DxC 800 pro Synchron (Beckman Coulter, Fullerton, CA, USA). Urinary levels of low-molecular weight Clara cell protein (CC16 ...
-
bioRxiv - Systems Biology 2024Quote: ... amplified libraries were size selected for a range of 400-800 bp using SPRIselect beads (Beckman Coulter). NGS was performed on an Illumina NextSeq550 or llumina HiSeq 2500 sequencer according to the manufacturers’ protocols with custom first-read primer (1:1 mix of GAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA and TGAGTGATTGACTACCCACGACGGGGGTCTTTCA).