Labshake search
Citations for Beckman :
1 - 50 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were analyzed using a Gallios multi-color flow cytometer instrument (Beckman Coulter, Brea, CA, USA) set up with the 3 lasers 10 colors standard configuration ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was purified using SPRIselect beads (Beckman Coulter), with a beads-to-sample volume ratio of 0.7 to remove primer dimers ...
-
bioRxiv - Synthetic Biology 2024Quote: ... After purification using SPRIselect beads (Beckman Coulter), plasmid DNA was transformed into electrocompetent E ...
-
bioRxiv - Plant Biology 2024Quote: ... The size of the cell population and the number of intact cells were measured using a Coulter Counter (Multisizer 4; Beckman Counter, Brea, CA, USA).
-
bioRxiv - Plant Biology 2024Quote: ... DNA fragments were then selected based on size using AMPure beds (Beckman Coulter). The concentration of the samples was measured using the Qubit dsDNA High Sensitivity kit and the Qubit Fluorometer (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... cultures were maintained at 1-2*106 cells/mL in semi-chemostat by daily dilution with fresh medium based on cell counts (Multisizer 4e coulter counter, BECKMAN COULTER, USA).
-
bioRxiv - Microbiology 2024Quote: ... samples were transferred to 50 ml Oakridge centrifuge tubes (Beckman Coulter) and vortexed three times at maximum strength for 1 minute at a time with 2-minute intervals on ice in between ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Red blood cells were lysed using Zap-oglobin-II Lytic Reagent (Beckman Coulter) prior to counting splenocytes on a Z1 Beckman Coulter Counter.
-
bioRxiv - Pathology 2024Quote: ... Calcium and phosphorus were analyzed using the Beckman AU480 Chemistry Analyzer (Beckman Coulter AU480). P1NP (procollagen type I N-terminal propeptide ELISA kit ...
-
bioRxiv - Neuroscience 2024Quote: ... Insoluble material was removed by ultracentrifugation for 45 min at 40000 g (Beckman, JA-25.50 rotor), and the supernatant was loaded onto Anti-DYKDDDDK affinity beads (Smart-Life Sciences ...
-
bioRxiv - Neuroscience 2024Quote: ... and final libraries were prepared and cleaned with SPRIselect Regent kit (Beckman Coulter, B23318). A small aliquot of each library was used for quality control to determine fragment size distribution and DNA concentration using a bioanalyzer ...
-
bioRxiv - Neuroscience 2024Quote: ... Lysates were then cleared by centrifugation at maximum speed in a Microfuge® 18 (Beckman) inside a 4°C cold room ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell viability as measured by Vi-Cell (Beckman Coulter) for all samples was above 90% ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resulting libraries were purified twice at 0.9X using Ampure XP Beads (Beckman Coulter, Indianapolis IN), and quantified using a Qubit 3.0 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... gradient (25 – 39 % OptiPrep, 309600 x g, 5 h, SW60Ti rotor (Beckman Coulter). Purification of VLPs was realized accordingly ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Flow cytometry was performed using a Cytoflex flow cytometer (Beckman Coulter, Brea, CA) and analyzed using CytExpert (Beckman Coulter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and analyzed using CytExpert (Beckman Coulter) software ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysates were cleared by centrifugation for 1 h at 45,000 rpm at 4°C (Optima XPN-80 Ultracentrifuge with 70 Ti, Beckman Coulter). HTP-tagged proteins were immunoprecipitated with 600 µl pre-washed IgG-sepharose 6 fast flow affinity resin (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... the pellet was suspended in 250 μl of cold FACS buffer and the resulting solution was finally sorted on a MoFloAstrios device (Beckman) to reach a concentration of 410 cells/μl.
-
bioRxiv - Cell Biology 2024Quote: ... All samples were acquired with a CytoFlex (Beckman Coulter) and analyzed using Flowjo (BD).
-
bioRxiv - Cell Biology 2024Quote: ... The ratio of transferred cells was quantified using a CytoFlex (Beckman Coulter) or Aurora flow cytometer (Cytek) ...
-
bioRxiv - Cell Biology 2024Quote: ... Gradients were centrifuged at 36,000 rpm for 2 h at 4 °C in an Optima L-100XP ultracentrifuge (Beckman–Coulter). Following centrifugation ...
-
bioRxiv - Neuroscience 2024Quote: ... on the Fragment Analyzer (Advanced Analytical, Ames, IA, USA) and cleaned up by using 1.0x Vol SPRI beads (Beckman Coulter). Libraries were sequenced Paired-End 41 bases on NextSeq 500 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... the samples were ultracentrifuged at 120,000 x g in a TLA100 rotor (Beckman Instruments, Fullerton, CA) at 4°C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... Followed by ultracentrifugation at 120,000 x g in a TLA100 rotor (Beckman Instruments, Fullerton, CA) at 4°C for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... libraries were amplified using PCR and amplicons were purified with AMPure XP beads (Beckman Couter, Brea CA) and indexed with Agilent SureSelectXT Index Set ILM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The DNA content of the cells was measured using a flow cytometer (Beckman Coulter, Pasadena, USA).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The cells were washed and resuspended in FACS buffer before being analyzed through flow cytometry (Beckman Coulter, Pasadena, USA). For immunofluorescence staining ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell fragments and insoluble material was removed by centrifugation at 60,000 rpm (70Ti rotor, Beckman) for 1 hour and the clarified supernatants were aliquoted and snap-frozen in liquid nitrogen.
-
bioRxiv - Synthetic Biology 2024Quote: ... BFP positive cells were sorted on a CytoFLEX S (Beckman Coulter).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the cell lysate was layered on top of a discontinuous OptiPrep® gradient (50 %, 35 %, 30 %, 20 %, and 15 %) and centrifuged at 135,000 g for 1 h at 4°C (Beckman L8-80M Ultracentrifuge, USA). The melanin pellet was recovered ...
-
bioRxiv - Synthetic Biology 2024Quote: ... kit and Agencourt AMPure XP beads (Beckman Coulter, USA), respectively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplicons were purified using SPRI beads (Beckman) and Sanger sequenced (Quintara Biosciences) ...
-
bioRxiv - Biophysics 2024Quote: NK-92 cell viability was determined using trypan blue exclusion assay and Vi-cell counter (Beckman). For NK-92 cytotoxicity assay with DAOY medulloblastoma cells ...
-
bioRxiv - Biophysics 2024Quote: ... Cell counting were performed with Cellometer (Nexcelom Bioscience) or Vi-cell (Beckman) counters then cells were used for cytology and cell staining ...
-
bioRxiv - Biophysics 2024Quote: ... The virions were harvested from the supernatant by centrifugation through 1.5ml of 30% sucrose at 10,000 RPM at 4°C for 2hrs (Beckman L8-70M Ultracentrifuge). The resulting pellet of virions was resuspended in 20ul of RIPA lysis buffer containing protease inhibitors.
-
bioRxiv - Cancer Biology 2024Quote: ... The fragments were repaired the 3’and 5’overhangs using End repair mix (component of SureselectXT) and purified using Agencourt AMPure XP Beads (Beckman). The purified fragments were added with ‘A’ tail using A tailing Mix (component of SureSelectXT ...
-
bioRxiv - Immunology 2024Quote: ... CD34 (581, ECD, Beckman Coulter, or PE-Dazzle, Biolegend), CD45 (HI30 ...
-
bioRxiv - Immunology 2024Quote: ... CD117 (104D2D1, PE-Cy5.5, Beckman Coulter), CD127 (R34.34 ...
-
bioRxiv - Immunology 2024Quote: ... All flow cytometry analyses were conducted using the CytoFLEX LX instrument (Beckman Coulter). Data analysis was performed with the FlowJo (v10.5.3 ...
-
bioRxiv - Cancer Biology 2024Quote: Plasma PTHrP was measured using an immunoradiometric assay (DSL-8100; Beckman Coulter) in which we substituted a rabbit anti-PTHrP (1–36 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.1× volumes (55 μl) of Ampure XP beads (Beckman Coulter, #A63880) were added and incubated for 10 min at RT ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting gradient was then subjected to centrifugation for 16 hours at 150,000 x g and 4 °C (SW55 Ti rotor, Beckman-Coulter). Sample banding was visually observed at the interface of the 30% and 20% fractions (Supporting Information ...
-
bioRxiv - Biophysics 2024Quote: ... RNA products purified with RNAClean XP beads (Beckman Coulter).
-
bioRxiv - Immunology 2024Quote: ... Data acquisition was performed with a CytoFLEX using the CytEXPERT software (Beckman Coulter), and data was analyzed with FlowJo Software v10.5 (Tree Star) ...
-
bioRxiv - Immunology 2024Quote: ... CD34 (581, ECD, Beckman), CD45 (HI30 ...
-
bioRxiv - Immunology 2024Quote: Antibodies and clones against the following proteins were used (clone, fluorophore, company): CD3 (UCTH1, PECy5, Beckman Coulter), CD7 (Horizon V450 or BUV395 ...
-
bioRxiv - Systems Biology 2024Quote: ... The liquid handler Biomek FX (Beckman Coulter) was used to prepare plates ...
-
bioRxiv - Systems Biology 2024Quote: ... After cleanup with AMPure XP Reagent (Beckman Coulter, 1:1 ratio beads:PCR), iPCR amplification was carried out with KAPA HiFi HotStart ReadyMix (Roche) ...
-
bioRxiv - Systems Biology 2024Quote: ... amplified libraries were size selected for a range of 400-800 bp using SPRIselect beads (Beckman Coulter). NGS was performed on an Illumina NextSeq550 or llumina HiSeq 2500 sequencer according to the manufacturers’ protocols with custom first-read primer (1:1 mix of GAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA and TGAGTGATTGACTACCCACGACGGGGGTCTTTCA).