Labshake search
Citations for Beckman :
301 - 350 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... viability assay in a microplate reader (Beckman Coulter DTX 880 Multimode Detector). For clonogenic survival assays ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C in SW41 rotor (Beckman Coulter). Polysomes profiles were obtained using Biocomp Piston Gradient Fractionator (BioComp Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR reaction was cleaned up with Ampure XP beads (Beckman Coulter, A63881). In addition ...
-
bioRxiv - Neuroscience 2024Quote: ... transferred to 3.5 mL ultracentrifuge tubes (Beckman Coulter), and centrifuged at 100,000 g for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The homogenate was filtered with a 70 µm strainer and transferred into an ultracentrifuge tube (Beckman Coulter, 331372). Sucrose solution (1.8 M sucrose ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were bead purified (AMPure XP, Beckman Coulter) and run on High Sensitivity DNA chips using a Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: Indexed libraries were bead purified (AMPure XP, Beckman) at a ratio of 0.6:1 beads:cDNA (30 μl beads:50 μl library for Smart-seq2 and 4.2 μl beads:7 μl library for Smart-seq3) ...
-
bioRxiv - Neuroscience 2024Quote: ... The amplified cDNA samples were purified with Ampure XP magnetic beads (Beckman Coulter, CA), quantified by Qubit fluorometer (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... and purified on Ampure SPRIselect beads (Beckman-Coulter #B23317). Poly-C-tails were added to 1 µg of each end-repaired sample in duplicate using Terminal Transferase (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... Fluorescence was determined using the CytoFlex LX Flow Cytometer (Beckman Coulter) and analysis was performed using FlowJo (version 9).
-
bioRxiv - Molecular Biology 2024Quote: ... The initial PCR products of rbcL F3R3 were purified using an Agencourt AMPure XP kit (Beckman Coulter, Fullerton, CA, USA). To construct the DNA libraries for the second PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA libraries of rbcL F3R3 were purified using an Agencourt AMPure XP kit (Beckman Coulter) and sequenced using an MiSeq Reagent Kit v3 (600-cycle format ...
-
bioRxiv - Neuroscience 2024Quote: ... cleaned up using 1.8X AMPure beads (Beckman Coulter), and quantified ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 30,000 xg for 45 min at 4 °C using a SW41 Ti swinging bucket rotor (Beckman Coulter) before the supernatant was decanted ...
-
bioRxiv - Neuroscience 2024Quote: ... at a ratio of 1:2.3 before layering on 3 ml of SCB in a 12 ml Thinwall Ultra-clear centrifuge tubes (Beckman Coulter). Samples were centrifuged at 30,000 xg for 45 min at 4 °C using a SW41 Ti swinging bucket rotor (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were purified with a dual-sided SPRI selection using Beckman Coulter Agencourt RNAClean XP beads (Beckman Coulter, A63987) and quantified with a BioAnalyzer.
-
bioRxiv - Neuroscience 2024Quote: ... by centrifugation at 5,000 x g at 4°C for 30 minutes in a fixed angle rotor (Beckman Coulter). The qEV column washed with 1x PBS was then loaded with 500 µL of concentrated supernatant followed by 2.5 mL PBS to collect 3 mL void volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... the filtered cell culture supernatants were concentrated by ultracentrifugation in a 50.2 Ti rotor (Beckman Coulter, Brea, CA) at 35,000 rpm for 90 min through an 8% Opti-prep (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The particle band was removed from the gradient by puncturing the side of the thin wall ultra-clear centrifuge tube (Beckman Coulter, Brea, CA) with a hypodermic syringe needle and pelleted in STE buffer at 40,000 rpm for 1 h by using an SW55 Ti rotor ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were sorted at the NINDS Flow and Imaging Cytometry Core Facility on the MoFlo Astrios Cell Sorter (Beckman Coulter Life Sciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cleanup and removal of excess TeloTag adapters was done using SPRI beads (Beckman Coulter, Cat. B23318) a ratio SPRI beads to DNA of 45 µL:100 µL was used ...
-
bioRxiv - Neuroscience 2024Quote: ... The homogenate was centrifuged (45 min, 16 000 rpm, 4°C, JLA 16.250 rotor, Beckman-Coulter Centrifuge Avanti J25-01) and the supernatant subjected to Ni-NTA affinity purification (HIS-Select Nickel Affinity Gel (Sigma Aldrich)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1U of FastAP (TFS, EF0654) for 15 min at 37 °C and purified using 1.2× SPRIselect beads (Beckman Coulter, B23318). The inDrops-v1.1 libraries were digested with 40U of ExoI and 1U of FastAP for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was selected and purified by AMPure XP beads (Beckman). The purified cDNA was end-repaired and then ligated with VAHTS RNA adapters ...
-
bioRxiv - Neuroscience 2024Quote: ... the cell lysate underwent centrifugation at 12,000 × g for 1 h (JA 25.50, Beckman Coulter) and supernatant was loaded to anti-Flag M2 affinity resin (GenScript) ...
-
bioRxiv - Molecular Biology 2024Quote: ... for ultracentrifugation at 100,000 rcf for 70 min at 4 °C using a Optima XE-90 ultracentrifuge with a SW 32 Ti rotor (Beckman Coulter). The EV pellet was resuspended in 0.22 μm-filtered sterile PBS and freshly-used or stored at −80 °C until further use ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant was transferred to ultracentrifuge tube (38.5 ml-Beckman Coulter Ultra-Clear™) for ultracentrifugation at 100,000 rcf for 70 min at 4 °C using a Optima XE-90 ultracentrifuge with a SW 32 Ti rotor (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting supernatants were layered onto 1.2M sucrose in 14 x 89 mm Ultra-Clear centrifuge tubes (Beckman, Palo Alto CA). The gradients were centrifuge at 4 °C 160,000 x g for 35 min (SW41 rotor ...
-
bioRxiv - Neuroscience 2024Quote: ... 5ul from each of the 96 libraries were pooled and cleaned using 0.8X SPRIselect beads (Beckman Coulter B23317). The average fragment size of the final library was quantified using a High Sensitivity D5000 Screentape (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... This was carefully layered on top of 2ml 35% iodixanol in a clear polycarbonate tube (Beckman 355672) and centrifuged at 10,000x g for 30 min at 4C with deceleration turned off ...
-
bioRxiv - Neuroscience 2024Quote: ... The samples were then ultracentrifuged in a TLA-55 rotor (Beckman Coulter) at 100,000x g ...
-
bioRxiv - Neuroscience 2024Quote: ... 20.000 rpm for 2 hours (Beckman). Collected viral particles were then suspended in DMEM and stored to –80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The supernatant was ultracentrifuged at 80,000 × g for 1 h at 4°C using a type 50 Ti rotor ultracentrifuge (Beckman Coulter). The supernatant ...
-
bioRxiv - Neuroscience 2024Quote: ... and 58% in Quick-seal polyallomer tubes (Beckman Coulter #342414) and spun in a Vti-50 rotor at 50.000 rpm for 75 min at 12°C in an Optima L-100 XP Beckman Coulter ultracentrifuge to remove any remaining contaminants ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Microbiology 2024Quote: ... rRNA-depleted RNA was purified using RNAClean XP beads (Beckman-Coulter Cat#66514), and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310) ...
-
bioRxiv - Microbiology 2024Quote: ... respectively) were gently layered on top of each other in ultracentrifuge tubes (Ultra-Clear 5 mL Tube, Beckman Coulter) and a continuous gradient was generated using a gradient maker (Gradient Master ...
-
bioRxiv - Microbiology 2024Quote: ... 50% (w/v) sucrose) was filled into ultracentrifuge tubes (Polypropylene 10 ml Tube, Beckman Coulter), the sheared grappling hooks were gently layered on top ...
-
bioRxiv - Molecular Biology 2024Quote: ... and subjected to dye-terminator cycle sequencing using DTCS Quick Start Mix (Beckman Coulter) and an automatic sequencer (CEQ 2000XL ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were cleaned with AMPure beads (Beckman Coulter, Brea, United States) at a 0.9:1 ratio according to the protocol to remove short fragments and primer dimers ...
-
bioRxiv - Molecular Biology 2024Quote: ... GFP expression was directly measured on a Cytomics FC500 (Beckman-Coulter) or a fluorescence microscope (Eclipse 80i ...
-
bioRxiv - Evolutionary Biology 2024Quote: The culture chambers were sampled daily from the middle of the culture to monitor population density through flow cytometry (Beckman Coulter CytoFLEX) starting 5 days after initial inoculation.
-
bioRxiv - Evolutionary Biology 2024Quote: ... then SPRIselect beads (Beckman Coulter) were used at full volume for fragment size selection ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteinase K digestion was performed and RNA-DNA chimeras precipitated from IP and input fractions before purification with AMPure XP beads (Beckman Coulter, A63882). RNA-DNA chimeras were digested with MmeI (NEB ...
-
bioRxiv - Microbiology 2024Quote: Growth assays and phage infection curves were performed in the BioLector microcultivation system (Beckman Coulter Life Sciences (formerly m2p-labs) ...
-
bioRxiv - Microbiology 2024Quote: ... incubated at 25°C and 5% CO2 (PF) or 37°C and 5% CO2 (BF) for 60 min and analyzed using a CytoFLEX flow cytometer (Beckman Coulter). Events (10,000 ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then analyzed using a CytoFLEX flow cytometer (Beckman Coulter). Values for FITC-H and PC5.5-H were recorded for 10,000 events and analyzed using FCSexpress software ...
-
bioRxiv - Microbiology 2024Quote: ... Culture density was monitored by flow cytometry at 24 h intervals using a CytoFLEX (Beckman Coulter).
-
bioRxiv - Microbiology 2024Quote: Raw data was preliminarily analyzed using CytExpert software (Beckman Coulter). Then it was analyzed using custom python scripts (https://github.com/fedorrik/scrapper and the doi ...