Labshake search
Citations for Beckman :
451 - 500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... WTA products were purified with Ampure XP beads (Beckman Coulter), quantified with Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... The virus was enriched by ultracentrifugation (Beckman Coulter Optima™ L-80XP) at 246,347g for 4 hours at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... This gradient was centrifuged in a SW60Ti rotor (Beckman Coulter) at 82.500xg for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting supernatants were layered onto 1.2M sucrose in 14 x 89 mm Ultra-Clear centrifuge tubes (Beckman, Palo Alto CA). The gradients were centrifuge at 4 °C 160,000 x g for 35 min (SW41 rotor ...
-
bioRxiv - Neuroscience 2024Quote: ... 5ul from each of the 96 libraries were pooled and cleaned using 0.8X SPRIselect beads (Beckman Coulter B23317). The average fragment size of the final library was quantified using a High Sensitivity D5000 Screentape (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... This was carefully layered on top of 2ml 35% iodixanol in a clear polycarbonate tube (Beckman 355672) and centrifuged at 10,000x g for 30 min at 4C with deceleration turned off ...
-
bioRxiv - Neuroscience 2024Quote: ... the cell lysate underwent centrifugation at 12,000 × g for 1 h (JA 25.50, Beckman Coulter) and supernatant was loaded to anti-Flag M2 affinity resin (GenScript) ...
-
bioRxiv - Neuroscience 2024Quote: ... 20.000 rpm for 2 hours (Beckman). Collected viral particles were then suspended in DMEM and stored to –80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 58% in Quick-seal polyallomer tubes (Beckman Coulter #342414) and spun in a Vti-50 rotor at 50.000 rpm for 75 min at 12°C in an Optima L-100 XP Beckman Coulter ultracentrifuge to remove any remaining contaminants ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Microbiology 2024Quote: ... Saliva was collected by expectoration into tubes on ice followed by centrifugation for 10 minutes at 4°C at 4000 x g (Beckman SX4750 rotor) to remove large debris and bacterial aggregates ...
-
bioRxiv - Microbiology 2024Quote: ... if required Flow analysis was performed on a CytoFLEX S (Beckman Coulter). Individual flow droplets were gated for lymphocytes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pooled PCR products were purified using Agencourt AMPure XP beads (A63881, Beckman Coulter) using a double size selection protocol and sequenced on the Illumina NextSeq 6000 platform (read length 2×150bp).
-
bioRxiv - Cell Biology 2024Quote: ... cell cycle progression was analyzed with a CytoFLEX LX (Beckman Coulter, Indianapolis, USA). DAPI ...
-
bioRxiv - Neuroscience 2024Quote: ... on the Fragment Analyzer (Advanced Analytical, Ames, IA, USA) and cleaned up by using 1.0x Vol SPRI beads (Beckman Coulter). Libraries were sequenced Paired-End 41 bases on NextSeq 500 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... The cell extract was centrifuged at 20,000 rpm in a JA 25.50 (Beckman) rotor for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... The lysate was centrifuged at 20,000 rpm for 20 min at 4 °C in a JA 25.50 rotor (Beckman) and the supernatant was filtered through a 0.45 µm syringe filter ...
-
bioRxiv - Cell Biology 2024Quote: ... All samples were acquired with a CytoFlex (Beckman Coulter) and analyzed using Flowjo (BD).
-
bioRxiv - Cell Biology 2024Quote: ... The ratio of transferred cells was quantified using a CytoFlex (Beckman Coulter) or Aurora flow cytometer (Cytek) ...
-
bioRxiv - Cell Biology 2024Quote: ... Gradients were centrifuged at 36,000 rpm for 2 h at 4 °C in an Optima L-100XP ultracentrifuge (Beckman–Coulter). Following centrifugation ...
-
bioRxiv - Pathology 2024Quote: ... Counting beads (Beckman coulter) were added in all samples to assess cell concentration.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were then treated with 50 nL of compounds or vehicle (DMSO) via acoustic dispensing (Echo, Beckman Coulter) and incubated for 24 h at 37°C and 5% CO2 ...
-
bioRxiv - Pathology 2024Quote: ... RNA was then isolated using Agencourt RNAdvanced Tissue Kit on a Biomeki7 (Beckman Coulter), including DNase treatment (RNAse-free DNase1 ...
-
bioRxiv - Pathology 2024Quote: RNA from rat liver tissue was snap frozen in RNAlater and lysed using lysis buffer (RNAdvanced Kit, A32646, Beckman Coulter), 20µL Proteinase K on a TissueLyser II (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... The cell concentration was measured at the indicated timepoints after inoculation by Coulter Counter Z2 (Beckman). For all strains ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the quantification of cell apoptosis ratio was detected using the Flow Cytometer (Beckman, CA, USA).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 18 ◦C for 1 h 45 min in a 50.2Ti rotor (Beckman-Coulter, Brea, CA, USA). After ultracentrifugation ...
-
bioRxiv - Neuroscience 2024Quote: ... All samples were acquired on a 13-color Cytoflex (Beckman Coulter). For each analysis ...
-
bioRxiv - Physiology 2024Quote: ... The entire contents of a well were added to 10 mL of Isoton Buffer (Beckman Coulter) and particle diameter measured using a Multisizer 3 Coulter Counter (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2024Quote: ... The supernatant was ultracentrifuged at 80,000 × g for 1 h at 4°C using a type 50 Ti rotor ultracentrifuge (Beckman Coulter). The supernatant ...
-
bioRxiv - Molecular Biology 2024Quote: ... for ultracentrifugation at 100,000 rcf for 70 min at 4 °C using a Optima XE-90 ultracentrifuge with a SW 32 Ti rotor (Beckman Coulter). The EV pellet was resuspended in 0.22 μm-filtered sterile PBS and freshly-used or stored at −80 °C until further use ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant was transferred to ultracentrifuge tube (38.5 ml-Beckman Coulter Ultra-Clear™) for ultracentrifugation at 100,000 rcf for 70 min at 4 °C using a Optima XE-90 ultracentrifuge with a SW 32 Ti rotor (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were size-selected using Ampure XP beads (Beckman Coulter), quality-checked on a Bioanalyzer DNA high sensitivity chip (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... Gradients were placed into a swing bucket rotor (Beckman Coulter, TLS 55) and centrifuged at ∼14.000 x g max (∼10900 x g average ...
-
bioRxiv - Neuroscience 2024Quote: ... and centrifuged at ∼14.000 x g max (∼10900 x g average) for 22 min at 4 °C (Beckman Coulter, MAX-XP). After centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... respectively) were gently layered on top of each other in ultracentrifuge tubes (Ultra-Clear 5 mL Tube, Beckman Coulter) and a continuous gradient was generated using a gradient maker (Gradient Master ...
-
bioRxiv - Microbiology 2024Quote: ... 50% (w/v) sucrose) was filled into ultracentrifuge tubes (Polypropylene 10 ml Tube, Beckman Coulter), the sheared grappling hooks were gently layered on top ...
-
bioRxiv - Neuroscience 2024Quote: ... transferred to 3.5 mL ultracentrifuge tubes (Beckman Coulter), and centrifuged at 100,000 g for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell sorting for RNA-seq was performed on a MoFlo Astrios (Beckman Coulter).
-
bioRxiv - Microbiology 2024Quote: ... rRNA-depleted RNA was purified using RNAClean XP beads (Beckman-Coulter Cat#66514), and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310) ...
-
2P-NucTag: on-demand phototagging for molecular analysis of functionally identified cortical neuronsbioRxiv - Neuroscience 2024Quote: The sorting was performed at the Zuckerman Institute Flow Cytometry Core using a MoFlo Astrios Cell Sorter (Beckman Coulter). Event rates were kept between 5000-10000 events per second ...
-
bioRxiv - Neuroscience 2024Quote: ... and analyzed using CytExpert version 2.6 software (Beckman Coulter).
-
bioRxiv - Neuroscience 2024Quote: ... Flow cytometry on fixed cells was performed using either a CytoFlex S or CytoFlex LS system (Beckman Coulter) and analyzed using CytExpert version 2.6 software (Beckman Coulter).
-
bioRxiv - Developmental Biology 2024Quote: ... mixed with 120 μl AMPure XP beads (Beckman Coulter) and incubated on a rotator mixer at room temperature for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... samples were ultracentrifuged at 160,000 xg for 2 h at 4 °C in ultracentrifuge tubes (Beckman Coulter Cat #328874). The resulting pellet contained the insoluble AMB-1 cell fraction and the supernatant contained the soluble fraction ...
-
bioRxiv - Cell Biology 2024Quote: ... Platelet concentration was measured with the Beckman Coulter T-540 (Beckman Coulter Inc., Brea, CA, USA) hematology analyzer and adjusted to 250 × 106 per mL with Tyrode-HEPES buffer supplemented with 1 mM MgCl2 ...
-
bioRxiv - Cell Biology 2024Quote: ... at 100000 g (SW28Ti rotor, Beckman Coulter) for 3 h after which the fraction above the iodixanol cushion was collected and resuspended in 10 ml of DPBS filtered with a 0.1 µm filter unit (Millex VV ...
-
bioRxiv - Cell Biology 2024Quote: ... FACSAria IIu (Beckton Dickinson) or CytoFlex LX (Beckman Coulter). Analysis was performed in FlowJo V9 or V10 (Beckton Dickinson) ...
-
bioRxiv - Cell Biology 2024Quote: ... Acquisition was performed on a CytoFlex LX (Beckman Coulter) and analysis via FlowJo V10 (Becton Dickinson).
-
bioRxiv - Cell Biology 2024Quote: Cell volumes were measured using a Coulter counter (Multisizer 4, Beckman Coulter), which is based on the principle that a cell traversing an orifice filled with electrolyte will produce an impedance change proportional to the volume of the cell due to displacement of electrolyte ...