Labshake search
Citations for Macherey-Nagel GmbH :
701 - 750 of 774 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Neuroscience 2020Quote: ... The total proteins were precipitated and prepared for Polyacrylamide Gel Electrophoresis using protein precipitator and resuspension buffer PSB/TCEP (Protein solving buffer and (tris(2-carboxyethyl)phosphine) TCEP reducing agent) from the NucleoSpin Triprep Kit (Macherey-Nagel, Hoerdt, France). The elution fraction containing RNA was further used for PCR analysis (see below) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we removed the last segments of the caudal section and preserved it in 96% ethanol before DNA extraction using the NucleoSpin® 96 Tissue kit (Macherey-Nagel). It is worth noting that the ablation of the last segments of the caudal section of earthworms does not affect their survival due to their regeneration capacity (e.g ...
-
bioRxiv - Plant Biology 2019Quote: Genomic sequences of the StGBSSI gene (Gene ID from NCBI: 102577459) were obtained from leaf DNA extracted using the NucleoSpin Plant II kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... mitochondrial and nuclear genomes we extracted genomic DNA from Pb-GFP infected hepatocytes treated or not with infusion using a NuceolSpin Tissue kit (Macherey-Nagel, Germany) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2021Quote: ... Eluates were digested with proteinase K and RNAse A and DNA fragments were purified using a PCR purification kit (Macherey-Nagel, #740609).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from a cell pellet obtained from 2-ml aliquots of the microbial cultures using the tissue DNA extraction kit (Macherey-Nagel, Germany). The amoA genes of AOB and AOA was amplified with primers amoA-1F/amoA-2R (66 ...
-
bioRxiv - Microbiology 2022Quote: ... Viral genome equivalents (vge) were determined by qPCR of DNA isolated from encapsidated virions isolated with NucleoSpin Blood kit QuickPure (Macherey-Nagel; 740569.250).
-
bioRxiv - Microbiology 2022Quote: ... Viral genome equivalents (vge) were determined by real-time quantitative PCR (qPCR) of encapsidated DNA isolated using the NucleoSpin Blood QuickPure (Macherey-Nagel; 740569.250). To generate mutated quasiviruses ...
-
bioRxiv - Cancer Biology 2019Quote: Cells pellet (1.5*10^6) were collected at different time points after LPS stimulation and DNA was extracted with the Nucleospin tissue kit (Macherey-Nagel, 740952). The genomic DNA was eluted in 50 μl of BE buffer (5 mM Tris/HCl ...
-
bioRxiv - Zoology 2020Quote: Approximately 50-100 mg of tissue (from the second pereopod) was used for DNA extraction using the NucleoSpin® Tissue Kit (Macherey-Nagel) following the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: Viral biodistribution analysis - Genomic DNA (gDNA) was extracted from the brain region of interest with the NucleoSpin®Tissue Kit (Macherey-Nagel) extraction kit and 100 ng of gDNA was used as a qPCR template ...
-
bioRxiv - Plant Biology 2019Quote: ... Extraction of total genomic DNA was conducted with the NucleoSpin Plant Kit in accordance to the manufacturer’s protocol (Macherey-Nagel, Düren, Germany). The concentration of the DNA samples was checked with a NanoDrop spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... All single fragment PCR reactions were realized using Phusion High-Fidelity DNA Polymerase (ThermoScientific) and PCR products were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). Overlap PCRs were carried out using 100 ng of each purified PCR products and the resulting fragment of interest was purified from agarose gel ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were prepared from the cells collected at the end of the screens as follows: Genomic DNA was extracted using the NucleoSpin® Blood XL kit (Macherey-Nagel) with a condition of 50e6-100e6 cells per column ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from 1 mL co-culture taken from different time points during the cultivation experiment using the NucleoSpin Tissue DNA extraction kit according to the manufacturer’s instructions (Macherey-Nagel, Düren, Germany). Cell numbers were quantified by direct epifluorescence microscopy of Sybr-green stained cells immobilized on agarose-coated slides to generate standard curves for qPCR as described previously [42] ...
-
bioRxiv - Genomics 2019Quote: ... CHP-100 and HS-SYII) and tissue (ES1 and RH) was extracted by using the column-based NucleoSpin® Tissue DNA extraction kit (Macherey-Nagel) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were realized using Phusion High-Fidelity DNA Polymerase (ThermoScientific) and PCR products were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). The overlap PCR product was purified from agarose gel and was directly used to transform wild type F ...
-
bioRxiv - Biophysics 2022Quote: ... and 6 µg total endotoxin free plasmid DNA (4 µg HaloTag-KIF5B1-560 plasmid DNA + 2 µg of α-tubulin-GFP) isolated using the NucleoBond Xtra Midi Plus EF kit (MACHEREY-NAGEL GmbH & Co ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA from the LAB strains was extracted using a NucleoBond AXG column and Buffer Set III (U0544A & U0603A, MACHEREY-NAGEL, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was amplified by PCR methods using the following oligo-DNA primers and the products were purified with micro spin columns (MACHEREY-NAGEL, 74060910). Each reverse primer also possesses T3 sequence for transcription.
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reaction was performed on the new synthetized vector to amplify the HA1-DCK*-P2A-GFP-HA2 sequence corresponding to the HDR (homology directed repair) DNA template and was purified using the NucleoSpin PCR Clean-up kit (Macherey-Nagel # 740609.10) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The isolation of gDNA was conducted either by using a column-based method following manufacturer’s instructions (NucleoSpin Microbial DNA kit, Macherey-Nagel, Düren, Germany) or an automated system (King Fisher Duo Prime System ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cultured alone C4-2B cells or the mixed co-cultured C4-2B/MC3T3-E1 were harvested for DNA extraction using the NucleoSpin Tissue kit (Macherey-Nagel Inc.). Primers against the nuclear and mitochondrial genomes were used for qRT-PCR (sequences provided in Supplementary Table S2 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The resulting powder was used for DNA extraction using the NucleoSpin® Tissue kit following manufacturer instructions (MACHEREY-NAGEL GmbH & Co. KG). DNA quantity and purity were checked with a Nanodrop One spectrophotometer (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: ... was added for 30 min at 37°C and DNA was purified using NucleoSpin Gel and PCR Clean-Up columns (Macherey-Nagel, #740609.250) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was extracted from approximately 100 mg of fresh leaf tissue samples using the NucleoSpin® Plant II protocols from Macherey-Nagel. Libraries were prepared using the TruSeq Nano DNA library preparation kit (Fa ...
-
bioRxiv - Molecular Biology 2023Quote: ... Bacteria were grown in Luria-Bertani Broth at 37°C and plasmid DNA was isolated using the Nucleobond Xtra midi kit (MACHEREY-NAGEL, 740410), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... exonuclease V was used to digest the linear DNA in the sample prior to isolation of the residual putative cirDNA using a DNA clean-up kit (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel, Germany). The final cirDNA preparation was dissolved in TE buffer ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from a cell pellet obtained from 2-ml aliquots of the microbial cultures using the tissue DNA extraction kit (Macherey-Nagel, Germany). The amoA gene of Ca ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 1.2 l LB-medium and incubated for 4 h at 37 °C before extracting plasmid DNA using Nucleobond Xtra Midi kit (Macherey-Nagel, C640003) according to the manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted from 8–12 mg of dried tissue using the NucleoSpin 96 Plant II kit (Macherey-Nagel GmbH & Co. KG) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... consecutive copies of 197 bp with modified 601 sequence were transformed into DH5α Escherichia coli strain and purified from four liters of culture by using plasmid DNA purification kit Nucleobond® PC 10000 (Macherey-Nagel). Three mg of the plasmids were digested with EcoRI HF (0.25 U/µg DNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: Bulk DNA of the meristematic region and the basal portions of the leaves was extracted using NucleoSpin Plant II kit (Macherey-Nagel, Germany). DNA concentration was determined using a Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... were then extracted from the agarose gel and the DNA purified following the manufacturer instruction (NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL)) ...
-
bioRxiv - Microbiology 2019Quote: Environmental DNA was extracted from 0.3 g of crushed rocks using NucleoSpin® Plant II Kit (Macherey-Nagel, Gmbh & Co. KG, Duren, Germany) according to the manufacturer’s instructions and quantified by Quant-iT dsDNA HS assay kit (Invitrogen molecular probes-Eugene ...
-
bioRxiv - Plant Biology 2021Quote: Extractions of total genomic DNA were generated from silica gel-dried leaf material using the NucleoSpin Plant II kit (Macherey-Nagel, Dueren, Germany) or from herbarium specimens using the CTAB DNA isolation method as modified by Borsch et al ...
-
bioRxiv - Evolutionary Biology 2020Quote: We extracted plant DNA of at least one diseased plant individual per site using the NucleoSpin® 96 Plant II kit (Macherey-Nagel, Germany). We obtained DNA for 134 out of the 171 diseased plant individuals ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were purified using Plasmid DNA Mini Kit I (Omega Biotech, cat# D6943-02) or Nucleobond Xtra Mid kit (Macherey-Nagel, cat# 740410.50), according to protocols supplied by the manufacturers ...
-
bioRxiv - Microbiology 2020Quote: ... and J321 was performed at the CDC according to a Nabsys solution-based protocol modified from the bacterial DNA protocol for AXG 20 columns and Nucleobond Buffer Set III (Macherey-Nagel, Bethlehem, PA). Purified DNA was sent to Nabsys for nicking ...
-
bioRxiv - Molecular Biology 2020Quote: ... The overnight culture was used to inoculate a 500 mL LB with the antibiotic and the plasmid DNA was isolated using NucleoBond Xtra Midi EF (Macherey-Nagel, Dueren, Germany). Sequence flanking the spacer sequences were amplified and were sequenced ...
-
bioRxiv - Microbiology 2021Quote: ... was linearized by AdeI restriction enzyme digestion and DNA was purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Düren, Germany). For in-vitro transcription ...
-
bioRxiv - Epidemiology 2020Quote: ... 20 µL of Proteinase K were added to 180 µL of crushed tick sample and DNA was extracted using the NucleoSpin® 96 virus Core kit (Macherey-Nagel, Germany) and the automatic platform Biomek4000 (Beckman Coulter) ...
-
bioRxiv - Microbiology 2019Quote: ... The strain was grown overnight in de Man-Rogosa-Sharpe (MRS) medium (Carl Roth, Karlsruhe, Germany) and DNA was extracted using the NucleoSpin 96 tissue kit (Macherey-Nagel, Düren, Germany), with an extra cell lysis step using 20 mg/mL of lysozyme (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: DNA extraction was performed from a single female 4th instar larva (ToLID ilPecGoss1) using the NucleoMag Tissue kit (Macherey-Nagel, Allentown, PA, USA). The high molecular weight DNA was prepared for PacBio sequencing using the SMRTbell Express Template Prep Kit 2.0 for Continuous Long Read (CLR ...
-
bioRxiv - Microbiology 2022Quote: ... The total genomic DNA of the insect individual and its symbionts was extracted using the NucleoSpin Tissue XS Kit (MACHEREY-NAGEL, Duren, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 ml of mutant culture from propagation round 3 were used for gDNA isolation using the Macherey-Nagel NucleoSpin Microbial DNA purification kit (Macherey-Nagel, Düren, Germany). Whole genome sequencing was performed via the INVIEW Resequencing service for bacterial genomes up to 10 Mb with an Illumina standard genomic library provided by Eurofins Genomics (Ebersberg ...