Labshake search
Citations for Bio-Rad :
101 - 150 of 7695 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... with 10 % 2-Mercaptoethanol and loaded onto 4-20% precast polyacrylamide gels (4561096, 5671095; Bio-Rad). Imaging was performed with enhanced chemiluminescent detection (34096 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Developmental Biology 2019Quote: ... using 9% SDS polyacrylamide gels and then transferred to a 0.2µM polyvinylidene fluoride (PVDF) membrane over 10 minutes (Bio-Rad Trans-Blot Turbo). Membranes were blocked with 5% skim milk in 0.05% TBS-T for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Physiology 2021Quote: ... 9% or 12% -SDS polyacrylamide gel electrophoresis and transferred to PVDF Immobilon membranes (Biorad). After 1h-saturation in TBS/0.2% Tween/2% milk (RT) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP signal was detected in 9:1 mix of Clarity:Clarity Max ECl reagent (BioRad) and captured using a Chemidoc Touch imager (BioRad).
-
bioRxiv - Microbiology 2019Quote: ... boiled (95°C, 10 min), centrifuged (1,000 × g, 2 min) and loaded on 10% or 4-20% SDS-PAGE gel (Bio-Rad). Following electrophoresis (60 min ...
-
bioRxiv - Microbiology 2023Quote: ... 10 min), centrifuged (1,000 x g, 2 min) and loaded on 10% or 4–20% SDS-PAGE gel (Bio-Rad). Following electrophoresis (60 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad, #1610710) and were heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (Bio-Rad ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... concentration of total aerobic GNB and of MDR-GNB were determined by plating serial dilutions (pure, 10−2, 10−4) of initial faeces or EA sample onto Drigalski agar (Bio-Rad) with or without 1mg/L cefotaxime ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by 4 incubations with BioBeads SM-2 (BioRad) to remove the detergent ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μl of 2×ddPCR Supermix (Bio-Rad), wild-type and mutant allele-specific TaqMan probes at a concentration of 0.25 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 7) and Western blotting samples were prepared by adding sample buffer (3× Laemmli Sample Buffer 1610747; BioRad) plus 3.57 M β-mercaptoethanol (2-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... equipped with an Aminex HPX-87C column (300 × 7.8 mm, 9 μm; Bio-Rad, CA, USA). The column was maintained at 40°C ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of desired elasticities with a Poisson’s ratio of 0.5 ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of elasticity ...
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Electrofocusing was performed in glass capillaries with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (#163-1112, #163-1192, Bio-Rad, USA). The second direction is standard SDS 5-10% PAGE followed by staining with Coomassie Brilliant Blue G-250 (#31-4-58-1 ...
-
bioRxiv - Bioengineering 2022Quote: ... ddPCR reactions were set up as follows: 11 μL 2×ddPCR™ supermix for probes (no dUTP) (BioRad), 0.2 μL FWD primer (100 μM) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR conditions followed the general Bio-Rad recommendations.9 Data was analyzed with QuantaSoft_v1.7 software (Bio-Rad) including automatic Poisson correction.9,11
-
bioRxiv - Developmental Biology 2019Quote: ... and gene-specific primers (Supplementary Table 9) on a CFX384 Touch Real-Time PCR Detection System (BioRad). TBP (TATA-binding protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mL of 10% ammonium persulfate (APS, Bio-Rad) and 70 μL of tetramethylethylenediamine (TEMED ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 10% (v/v) 2-mercaptoethanol (Bio-Rad 1610710) was combined 1:3 with the prepared protein and then incubated at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 10% glycerol) and eluted in 2× loading buffer (Biorad) with β-mercaptoethanol by boiling for 5 min at 95°C.
-
bioRxiv - Microbiology 2021Quote: ... were resolved by 10% denaturing PAGE in Mini Protean 3 Cell (Bio-Rad). Separated RNA was then transferred to a nylon membrane (Hybond-XL ...
-
bioRxiv - Biophysics 2019Quote: ... N-methylene-bis-acrylamide (Bio-Rad, Herculers, USA) are added ...