Labshake search
Citations for Bio-Rad :
1 - 50 of 7695 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2×2 mm squares were cut out and placed into double-sided sticky 9×9 mm frame seals (Bio-Rad SLF0201) on a glass slide ...
-
bioRxiv - Cell Biology 2021Quote: ... and 9:10 laemmli (Bio-Rad)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Biophysics 2020Quote: ... using a 9 × 9 mm2 frame seal (SLF0201, Biorad). The chamber was plasma-treated to improve wettability ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules, CA) were then secured to a coverslip ...
-
bioRxiv - Biophysics 2022Quote: ... Frame-seal slide chambers (9 × 9 mm, Bio-rad, USA) were affixed to the glass coverslips ...
-
bioRxiv - Molecular Biology 2019Quote: ... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Biophysics 2021Quote: ... Frame-seal slide chambers (9 x 9 cm2, Bio-Rad, Hercules, USA) were affixed to the glass ...
-
bioRxiv - Immunology 2021Quote: ... clone AT152-9 (BioRad). To aggregate FcγRIIA ...
-
bioRxiv - Microbiology 2024Quote: ... 9 µm (Bio-Rad) with isocratic mobile phase 0.005 mol L−1 H2SO4 ...
-
bioRxiv - Neuroscience 2024Quote: ... Frame-Seal slide chambers (9 x 9 mm2, Biorad, Hercules, USA, SLF-0601) were affixed to the glass and 50 µL of poly-L-lysine (70k-150k molecular weight ...
-
bioRxiv - Microbiology 2019Quote: ... caspase-9 and caspase-3 was done using a CFX-96 real-time PCR system (BioRad, Hercules, CA, USA). The reaction mixture for each sample carried 2 µL of cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Cell Biology 2020Quote: ... n,n’-methylene-bis-acrylamide (BIORAD, 2% w/v stock solution), N-6-((acryloyl)amino)hexanoic acid crosslinker (N6 ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2022Quote: ... Plasma cleaned coverslips were affixed to Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules, CA) and the chamber was filled with about 50 µl poly-L-lysine solution (Sigma Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
bioRxiv - Biophysics 2023Quote: ... An imaging chamber was created on the coverslips using Frame-seal slide chambers (9×9 mm2, SLF0201, Biorad) and coated with 0.01 % w/v poly-L-lysine (PLL ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... bromophenol blue) was applied onto IPG strip (7 cm, pH 3-10, Bio-Rad, 1632000) for 24 h ...
-
bioRxiv - Physiology 2023Quote: ... Samples were run 16 h at 9 °C at 4 V with a 1–10 running ratio in TBE buffer using CHEF-DRII system (Bio-Rad). After the run ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Biophysics 2023Quote: ... An imaging chamber was created on the coverslips using frame-seal slide chambers (9×9 mm, SLF0201, Bio-rad). The glass in the chamber was coated with 70 μl of poly-L-lysine (PLL ...
-
bioRxiv - Biophysics 2023Quote: ... An imaging chamber was created on the coverslips using frame-seal slide chambers (9×9 mm, SLF0201, Bio-rad). The glass in the chamber was coated with 70 μl of poly-L-lysine (PLL ...
-
bioRxiv - Genomics 2020Quote: ... were seeded per well in 6-well plates (2 ml per well). 24 hrs later cells were transfected with siRNA (Supp. Table 9) using SilentFect (Bio-Rad) in biological triplicates ...
-
bioRxiv - Neuroscience 2022Quote: Samples were loaded on a home-made 9 or 10% Bis-Acrylamide (Bio-Rad) gel and the gel was subsequently transferred by wet transfer to a PVDF membrane (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were resolved on 7 cm pH 3-10 immobilized pH-gradient (IPG) strips (Bio-Rad), under mineral oil ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Protein lysates were boiled in loading buffer [1:9 ratio of 2-mercaptoethanol:4x Laemmli Sample Buffer (Cat.#1610747; Bio-Rad Laboratories)] for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG) strips (Bio-Rad 1632014) and rehydrated overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... a PDMS pad was attached to the coverslip via a Frame-Seal Incubation Chamber (9 mm×9 mm or 15 mm×15 mm, Bio-Rad). We connected the medium inlet and outlet of the PDMS pad to silicone tubes and started flowing an LB or M9 medium immediately at the flow rate of 2 mL/h using syringe pumps (NE-1000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad) for passive rehydration overnight at 20 °C in a Protean IEF Cell equipment (BioRad) ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Developmental Biology 2022Quote: ... 9 μl of Precision Melt Mix (1725112, Bio-Rad), 0.5 μl of each of forward and reverse primers (Table S4) ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 9 cycles in 96-well Thermal cycler (Biorad) and purified with Qiagen MinElute PCR purification kit ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...