Labshake search
Citations for Bio-Rad :
51 - 100 of 7695 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... Denatured protein extracts were resolved using 4-9% SDS-PAGE (4–15% Mini-PROTEAN® TGX™ Precast Protein Gelscat# 4561083, Biorad) and then transferred to a nitrocellulose membrane.
-
bioRxiv - Systems Biology 2023Quote: ... then cells stained for analysis by flow cytometry 9 or 10 days after dCas9 infection (BioRad ZE5). In some cases ...
-
bioRxiv - Zoology 2020Quote: ... 9 μL of iQTM SYBR® Green Supermix (Bio-Rad), 0.6 μL of each of the F1534f and C1534r primers ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were collected and phosphorylated 2-(3H) deoxyglucose was separated by Poly-Prep columns (BioRad). The final eluates were mixed with Ultima Gold Scintillation fluid at a 1:7 Ratio in scintillation tubes and analysed with a beta counter.
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1.6 μL H2O and 11 μL 2× ddPCR Supermix (Bio-Rad #1863024). 20 μL of ddPCR mixes were used to generate droplets in a QX200 Droplet Generator (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were in-gel rehydrated for 16 hrs and isoelectrically focused on 7 cm pH 3-10 IPG strips to 10,000 Vh on a Protean® IEF Cell (BioRad). After focusing ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2021Quote: ... MMP2/9 secretion was quantified using Quantity One Software (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Cell Signaling MAPK Panel 9-plex (BioRad, USA; LQ00000S6KL81S) and Bio-Plex Pro Cell Signaling Akt Panel 8-plex (BioRad ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... The protein extract was solubilized in 2-D lysis buffer (30 mM Tris-HCl pH 8.8, containing 7 M urea, 2 M thiourea and 4% CHAPS. Protein concentration was measured using Bio-Rad protein assay method ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit F(ab’)2 anti-mouse IgG conjugated to FITC (STAR9B, BioRad), and rabbit F(ab’)2 anti-rat IgG conjugated to FITC (STAR17B ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Molecular Biology 2019Quote: ... Denatured proteins (20-40 µg) were electrophoresed in 9% SDS-PAGE gels or MiniPROTEAN® TGX™ 4-15% Precast gels (BIORAD), transferred onto a nitrocellulose membrane and probed with specific antibodies ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: Purified SARS-CoV-2 N protein was electrophoresed on 4-10% SDS-PAGE (Bio-Rad) and stained with Coomassie Brilliant Blue G-250 (CBBG-250) ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Cancer Biology 2021Quote: ... and rabbit F(ab’)2 anti-rat IgG conjugated to FITC (STAR17B, BioRad).
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ...