Labshake search
Citations for Bio-Rad :
4001 - 4050 of 9407 citations for Mouse Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Proteins were resolved in 6-8-10 or 12% polyacrilammide gels and transferred to PVDF (Bio-Rad, Hercules, CA,USA) or nitrocellulose membranes (GE Heath Care ...
-
bioRxiv - Neuroscience 2022Quote: ... Aliquots of the lysates containing 10 mg of protein were denatured in Laemmli buffer and β-mercaptoethanol (Bio-Rad, USA) at 95°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... A small portion of the lysate was boiled for 10 min with 2X SDS Laemmli sample buffer (Bio-Rad, 1610737) with BME and saved as total protein samples ...
-
bioRxiv - Neuroscience 2022Quote: ... 15 μg of protein was ran via SDS-PAGE in 10% Tris-tricine gels using BioRad protean mini and then rapid transferred to PVDF membranes using BioRad Semi-dry (BioRad). Membranes were subsequently blocked using 5% BSA in 1X TBST for one hour and then incubated with either 1° (1:1,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transferred to a 0.4 cm cuvet for a 10 ms pulse of 300 V on a BTX Square-Wave electroporator (Bio-Rad). Cells were rested 15 min at room temperature and then transferred to 10 ml antibiotic-free medium and incubated overnight ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg of protein was separated by SDS-PAGE using 12% acrylamide Mini-protean TGX precast gels (Bio-Rad, USA). Gels were stained with Coomassie (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein samples were loaded on 10%-12% polyacrylamide gels and transferred onto 0.45 µm pore-size nitrocellulose membranes (Bio-Rad) using the Turboblot (BioRad) ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... snap frozen tumoroid cell pellets were lysed in Phosphatase-substituted RIPA buffer and run on a 10 % precast gel for P53 detection (BioRad). Protein levels of P53 (1:1.000 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of each sample was loaded into a well of a 10% Mini-PROTEAN TGX Precast Gel (Bio-Rad). Gels were transferred to PVDF membranes (Merck KGaA ...
-
bioRxiv - Genomics 2022Quote: Slot blot was performed using 1.5 ng of gDNA that was denatured in 400 mM NaOH/10 mM EDTA and blotted onto nitrocellulose membrane (BioRad) in duplicate for dsDNA and 5mC DNA using a slot blot apparatus (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Cell Biology 2019Quote: ... were boiled for 5 min and then loaded into 10% Mini-Protean TGX (Tris-Glycine eXtended) Stain-Free precast Gels (Biorad). Electrophoresis was performed in a buffer containing 25 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on a 10% SDS-polyacrylamide gel and then transferred to a nitrocellulose membrane (BioRad, Boston, MA, USA). The membrane was incubated with the appropriate primary antibody and then incubated with a species-appropriate secondary antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... boiled at 99 °C for 10 min and supernatants were loaded on 4–12% Criterion XT Bis–Tris precast gel (Biorad). The gel was fixed with 40% Methanol and 10% acetic acid and then stained for 1 hour using colloidal coomassie dye G-250 (Gel Code Blue Stain ...
-
bioRxiv - Microbiology 2020Quote: ... and destained with 30% methanol,10% glacial acetic acid in double distilled water and subjected to film by ChemiDoc systerm (BioRad).
-
bioRxiv - Immunology 2020Quote: The VSGm protein samples were separated on 10% SDS-PAGE then trans-blotted onto two separate nitrocellulose membranes using the mini PROTEAN II Trans-blot unit (Biorad). The membranes were rinsed in 1x PBS (0.1% w/v ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μg total protein was separated on 10% SDS-PAGE gels and blotted onto Immun-Blot PVDF membrane (Bio-Rad). LSD1-GFP ...
-
bioRxiv - Physiology 2021Quote: ... Approximately 10 µg of protein was loaded into a 4% - 20% Criterion pre-cast gel (Bio-Rad, Hercules, CA, USA) and resolved at 120 V for 120 min ...
-
bioRxiv - Microbiology 2020Quote: ... brucei were separated by SDS-PAGE (8% or 10%) and immunoblotted on TransBlot Turbo Midi-size PVFD Membranes (Bio-Rad) (48) ...
-
bioRxiv - Neuroscience 2021Quote: ... We ran 40 µg of protein on 10% gels using the Mini-PROTEAN Tetra Cell western blotting system (Bio-Rad). Anti-NaV1.1 (Ab5204a ...
-
bioRxiv - Biochemistry 2020Quote: ... samples corresponding to equal amounts of protein were separated on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane by the wet tank blot method (BioRad, according to manufacturer’s instructions) ...
-
bioRxiv - Biochemistry 2020Quote: The protein storage buffer for purified Pol IV and Pol IVT120P was exchanged to 10 mM potassium phosphate (pH 7.5) with Micro Bio-Spin P-30 Chromatography Columns (Bio-RAD) right before the measurements ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were then sonicated and heated to 95 °C for 10 minutes prior to being evenly loaded onto SDS-polyacrylamide gels using the Mini Trans-Bot electrophoresis system (Biorad), followed by transfer to PVDF using standard western blotting procedures.
-
bioRxiv - Neuroscience 2022Quote: ... protein samples (10-30 μg) were boiled and separated on precasted 4-20% Criterion TGX Stain-free gels (Bio-Rad) and transferred to a nitrocellulose membrane (Amersham Protran 0.2um NC ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR reaction was carried out in 10 μl volume with 5 μl of 2X iTaq Universal Sybergreen Supermix (BioRad), 500 nM of forward and reverse primers (for promoter ...
-
bioRxiv - Microbiology 2022Quote: ... rinsed 3x with DI water 10 minutes each and stained overnight with agitation in QC colloidal Coomassie stain (Bio-Rad). The gel was rinsed with DI water 3x for 10 min and imaged using a ChemiDoc Touch Imaging System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 or 12.5% bis-tris gels and protein was transferred to PVDF membranes using a wet transfer system (Bio-Rad). Membranes were blocked with 5% milk in TBS-T and incubated overnight with primary antibody in either milk or BSA at manufacturer recommended concentrations ...
-
bioRxiv - Cell Biology 2022Quote: All proteins were snap frozen in single-use aliquots and protein purity was assessed by 10% SDS-PAGE (BioRad Laboratories) and stained with Coomassie Brilliant Blue (Supplemental Figure S1).
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biochemistry 2019Quote: ... The DNA recovery from this sample applied Chelex 100 Resin (Bio-Rad, 10% w/v in 500 μL in ddH2O) with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA samples were fragmented for 10 minutes on ice in 0.2 N NaOH and purified on Bio-Spin P30 columns (Bio-Rad). Biotin-labelled RNA was then purified using MyOne Streptavidin C1 Dynabeads (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2019Quote: ... Triplicate PCR reactions were performed in 20 µl final volume with 10 ng of fragmented gDNA using the ddPCR Supermix for Probes (No dUTP) master mix (Biorad) with 11-11 pmol primers and 50-50 pmol of TaqMan probes (for sequences of primers and probes see Table 1 below) ...
-
bioRxiv - Immunology 2019Quote: ... Equal amount of cell lysates (10 μl) were loaded in 4–12% Mini-PrROTEAN TGX Precast protein Gels (Bio-rad) and transferred to PVDF membrane ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Supernatants were analyzed on 10 % (w/v) SDS-PAGE gels with a Miniprotean III electrophoresis system (Bio-Rad; CA, USA). For western-blots ...
-
bioRxiv - Molecular Biology 2019Quote: ... Subsequent gel exclusion chromatography of loaded liposomes over a 10 mL BioGel A-0.5 M agarose resin (BioRad 151-0140) revealed no detectable AmB in the salt volume and essentially all of the AmB was retained by liposomes ...
-
bioRxiv - Plant Biology 2019Quote: ... Equal amounts of the eluted proteins were separated on 10% SDS-PAGE gels and blotted onto PVDF membranes (Bio-Rad). GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... Equal amounts of the eluted proteins were separated on 10% SDS-PAGE gels and blotted onto PVDF membranes (Bio-Rad). GFP- and RFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000 ...
-
bioRxiv - Biochemistry 2019Quote: ... 10% of 2 mM EGTA eluates were concentrated and separated on 4%– 20% gradient SDS-polyacrylamide Tris-glycine gels (Biorad). Total protein content was visualized by silver staining ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Cell Biology 2019Quote: ... Typically 10-25 μg total protein was separated on reducing SDS-PAGE (4-15% or 4-20% gradient gels, BioRad). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Microbiology 2020Quote: One hundred μg of the different PAO1 cytoplasmic extracts were loaded onto conventional SDS-PAGE 10% Bis-Tris gels (mini-protean TGX Stain-free precast Gels, BioRad). The gel was stained with Coomassie blue and each lane was cut into 10 bands ...
-
bioRxiv - Physiology 2020Quote: ... 10-25 µg of total protein was loaded in a 15-well pre-casted gradient gel (Bio-rad, 456-8086). After electrophoresis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 or 10 μL of the supernatant were resolved on an Any kD TGX Stain-Free protein gel (4568126, BioRad) alongside a Chameleon Duo Pre-Stained Protein Ladder (928-60000 ...
-
bioRxiv - Physiology 2020Quote: ... The supernatant was collected following centrifugation at 8,000g for 10 min and protein concentrations were determined in triplicate using the Bradford method (Bio-Rad). Ten micrograms of protein were subjected to SDS-PAGE on 4–20% Criterion TGX Stain-Free Protein Gel (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 10 min at 21,000 × g at 4°C and Bio-Rad protein assay reagent (Bio-Rad) was used to determine the protein concentrations of lysates ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were washed twice with 1x lysis buffer plus 10 mM imidazole before loading onto a disposable column (Bio-Rad). After two washes (lysis buffer plus 25 mM imidazole) ...
-
bioRxiv - Microbiology 2019Quote: ... according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad). cas9 mRNA and 16srRNA were analyzed with the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were heated at 90°C for 10 minutes and loaded onto a 4-20% precast polyacrylamide gel (BioRad). The gel was stained with SimplyBlue SafeStain (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... gels (4.5% acrylamide stacking gel and 10% acrylamide resolving gel) and were then transferred to 0.45 µm nitrocellulose membranes (Bio-Rad) using a semi-dry transfer system (Trans-Blot Turbo ...