Labshake search
Citations for Bio-Rad :
3901 - 3950 of 7321 citations for 4S 6 8 difluoro 3 4 dihydro 2H 1 benzopyran 4 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Biophysics 2024Quote: ... Primer extension reactions were desalted by spinning in the P-6 micro-biospin column (BioRad). Each sample was diluted in deionized formamide (Hi-Di™ Formamide ...
-
bioRxiv - Biochemistry 2024Quote: ... A transfer sandwich was constructed using 6 transfer buffer-soaked blotter papers (#1704085, BIO-RAD) (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... IL-1β and IL-6 CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The sequences of the primers used ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM DTT and 0.5% OGNPG) on a Micro Bio-Spin 6 column (Bio-Rad) and then diluted to a concentration of 10 mg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: After running through 8% SDS-polyacrylamide (SDS-PAGE; made in house) by gel electrophoresis (BioRad, Hercules, CA, USA), the proteins were transferred ...
-
bioRxiv - Genomics 2021Quote: ... were resolved on 8-12% Tris-glycine SDS-polyacrylamide gels and transferred to nitrocellulose blotting membranes (Bio-Rad), following standard procedures ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini-Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... were loaded onto an 8-channel DG8TM cartridge for droplet generation in the QX200 Droplet Generator (Bio-Rad). Droplets were transferred into a 96-well plate (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... SDS-PAGE was performed using 8-16% gradient gel and transferred to nitrocellulose paper using the Transblot (BioRad). Western blots were carried out using iBind with 1 ug/ml primary antibodies and 1 ug/ml secondary antibodies following iBind protocol (Invitrogen/ThermoFisher).
-
bioRxiv - Genomics 2020Quote: ... quantifying 8 mRNAs and 10 circRNAs of interest with the SsoAdvanced™ Universal SYBR Green Supermix (BioRad, USA). All reactions were performed in 384-well plates on the LightCycler480 instrument (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were buffer exchanged into 150 mM of ammonium acetate pH 8 using Bio-Spin P6 columns (BioRad) and the final protein concentrations were adjust to 1-5 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini- Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... 8 ng of granuloma protein was loaded per lane into Any kD Mini-PROTEAN TGX gels (Bio-Rad), separated by SDS-PAGE and transferred to 0.2 μm nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... serum insulin was performed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (Bio-Rad, Hercules, CA) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: gp120 or SOSIP glycoproteins were separated on 8–16% SDS-PAGE (mini-PROTEAN TGX protein gels; Bio-Rad) and transferred to a 0.45 μm nitrocellulose membrane (catalog number 1620115 ...
-
bioRxiv - Genomics 2023Quote: ... the ligation products were amplified by 8 cycles of PCR on an S1000 thermocycler (Bio-Rad, Hercules, CA) using Q5 High-Fidelity PCR master mix with HF buffer (NEB Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each amount of protein was loaded into 8-16% Mini-PROTEIN TGX Precast Protein Gels (Bio-Rad, #4561106) and then transferred to Trans-Blot Turbo Mini 0.2 µm PVDF Transfer Packs (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... 72°C for 8 sec with CFX Connect™ Real-Time System instrument (Bio-Rad, Mississauga, Ontario, Canada). Primer sequences are listed in Supplementary Table 1 ...
-
bioRxiv - Immunology 2024Quote: ... The samples were subsequently mixed with 8 µl of 4x Laemmli protein sample buffer (Bio-Rad, Cat# #1610747) and boiled for 10 min for immunoblotting.
-
bioRxiv - Plant Biology 2024Quote: Equal amounts of protein (60 µg) were resolved on 8% SDS-PAGE gels (Mini-PROTEAN, Bio-Rad, UK) and transferred on to a nitrocellulose membrane ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were separated on 8% Bis-Tris gels by SDS-PAGE and transferred to PVDF membranes (Bio-Rad). The PVDF membranes were blocked in 10% skim milk (FUJIFILM Wako ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Microbiology 2024Quote: ... and transcript quantification (QuantStudio 3, Bio-Rad Laboratories Inc., Hercules, CA) were performed as previously described (29).
-
bioRxiv - Cell Biology 2024Quote: ... in a Mini-PROTEAN®3 System (Bio-Rad, Hercules, CA). After electrophoresis ...
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...