Labshake search
Citations for Bio-Rad :
201 - 250 of 1234 citations for 6 Bromo benzo c isothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qRT-PCR was performed in a 2-step amplification with 40 cycles of 95 °C for 30 s and 55 °C for 30s using a Bio-Rad IQ thermocycler (Bio-Rad Laboratories Inc. Hercules, CA). Each reaction was loaded on a 384-wells standard qPCR plate and ran in triplicates ...
-
bioRxiv - Molecular Biology 2023Quote: ... The enzymes were subsequently incubated at temperatures from 30 °C to 54 °C for one hour using a PCR thermocycler machine (Bio-Rad Laboratories, Hercules, CA, USA), followed by cooling for 10 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR amplification conditions were initial denaturation at 95°C for 10 min followed by 40 cycles of 95°C for 10 s and annealing at 58-65 °C for 30 s (Bio-Rad CFX Connect Real-Time PCR) followed by melt peak analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Immunology 2021Quote: ... Settings for analysis using a C-1000 CFX96 machine (Bio-Rad) were as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... overnight at 37 °C in a G1000TM Thermal cycler (BIO-RAD) to digest trehalose to produce free glucose ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... then to 97°C for 8 min in a thermocycler (BioRad). We centrifuged the samples and froze the supernatant for further use.
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-cytochrome c (AHP2302, Bio-Rad Laboratories, 1:500), and mouse monoclonal anti-β-actin (A5441-.2ML ...
-
bioRxiv - Microbiology 2019Quote: ... 72°C,20"]x45 using SSO Advanced SYBR Green Supermix (BioRad), and 300 nM Tox9 and 11 primers listed in Table S1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... at 75°C for 10 minutes (T100 Thermal Cycler, Bio-Rad). The denatured proteins were pelleted through centrifugation at 3,200 g for 2 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... at 75°C for 10 minutes (T100 Thermal Cycler, Bio-Rad). The denatured proteins were pelleted through centrifugation at 3,200g for 2 minutes.
-
bioRxiv - Physiology 2023Quote: ... and transferred (100V, 1h, 4°C) onto PVDF membranes (Bio-Rad). Blots were blocked in buffer containing 5% BSA (Cat#A9418 ...
-
bioRxiv - Biochemistry 2023Quote: ... 59 and 61°C in an S1000 thermal cycler (Bio-Rad). For CETSA with dose-response ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were lysed using EBC buffer (Bio-Rad Cat. # C-1410) supplemented with protease EDTA-free (Cat # ...
-
bioRxiv - Neuroscience 2023Quote: ... and 72°C 15 s using a PCR machine (T100, Biorad). PCR primer pairs used were 5’-TCCCAGCCTGAAAGCCACAG-3’ and 5’-ATGCTGCTGGGATTCTCTCCC-3’ for Pet1 ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were incubated overnight at 4°C with STAR5B Streptavidin:HRP (BioRad) at a 1:15,000 dilution in 1x PBST ...
-
bioRxiv - Neuroscience 2024Quote: ... the iScript™C gDNA Clear cDNA Synthesis Kit (BIO-RAD) was employed ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were assessed using 6% polyacrylamide gel (made with 29:1 Acrylamide/Bis Solution, Bio-Rad) electrophoresis ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was quenched with 2µl of 10mM EDTA and desalted with Microbio-spin 6 column (BioRad) to remove unincorporated nucleotides ...
-
bioRxiv - Biochemistry 2020Quote: ... The thiol-reduced protein was exchanged into anaerobic 0.5x TNG buffer using Microbiospin 6 columns (Bio-Rad). The protein concentration was determined by the Bradford assay (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... separated on 6% acrylamide 8M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein lysates (50µg) were loaded on a 6% SDS-PAGE gel and transferred to nitrocellulose membrane (BioRad) using a wet electroblotting system (BioRad) ...