Labshake search
Citations for Bio-Rad :
2351 - 2400 of 5406 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR reaction was analyzed on CFX opus Real-Time PCR device (Bio-Rad) and data were normalized to the expression levels of GAPDH as housekeeping gene.
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed real-time PCR with SsoAdvanced Universal SYBR Green Supermix (Biorad). The expression of target genes was normalized to GAPDH ...
-
bioRxiv - Molecular Biology 2024Quote: ... RT-qPCR was performed by the CFX96 Real-Time PCR system (Bio-Rad) using TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time PCR was performed using qPCR SYBR Green master mix (Bio-Rad) in the CFX-96 Bio-Rad PCR machine (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... qRT–PCR data was analyzed using CFX Manager™ software (Version 3.1) (BioRAD) and GraphPad Prism (Version 9.0) ...
-
bioRxiv - Plant Biology 2024Quote: ... was used with a CFX Connect Real-Time PCR Detection System (BIO-RAD) for qPCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Optical Microseal ‘B’ PCR Plate Sealing Film (Bio-Rad, cat. no: MSB1001). PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... was performed with an CFX96 TouchTM Real-Time PCR detection system (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CFX Opus 96 Real-Time PCR System (Bio-Rad Laboratories, CA, USA) was utilized to determine the relative mRNA expression levels ...
-
bioRxiv - Microbiology 2024Quote: ... Emulsified PCR reactions were performed with a C1000 Touch thermal cycler (Bio-Rad), with the following protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative real-time PCR was performed using SsoFast EvaGreen Supermixes (Bio-Rad, 1725200). Primers for qPCR of Lmx1b were the sequences F ...
-
bioRxiv - Genetics 2024Quote: ... Thermo Fisher Scientific) on the CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... The following program on CFX96 Touch Real-Time PCR Detection System (BIO-RAD) was used ...
-
bioRxiv - Genomics 2024Quote: ... The PCR was performed on a T100™ thermal cycler (Bio-Rad, USA).
-
bioRxiv - Genetics 2024Quote: ... and a CFX384 Touch Real-Time PCR Detection System (BioRad, Hercules, California, USA). The amplification program consisted of an initial denaturation at 95°C for 2 minutes ...
-
bioRxiv - Immunology 2024Quote: ... utilizing a CFX96 Touch real-time PCR detection system (Bio-Rad, Hercules, CA). Relative quantitation of mRNA expression was calculated using the 2−ΔΔCt method ...
-
bioRxiv - Immunology 2024Quote: ... Droplets were then amplified by PCR in a thermal cycler C1000 (Bio-Rad) following manufacturer’s instructions and fluorescence intensity was measured in a QX200 Droplet Reader (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: ... Quantitative PCR (qPCR) was performed using iTaq Universal SYBR Green Supermix (Bio-Rad). Data were normalized by the abundance of GAPDH mRNA ...
-
bioRxiv - Immunology 2024Quote: ... Real-time PCR was performed with iTaq Universal SYBR Green Supermix (Bio-Rad) on a Bio-Rad Real-time System C1000 Thermal Cycler ...
-
bioRxiv - Microbiology 2024Quote: ... and qRT-PCR was performed using an iQ SYBR-Green Supermix (Bio-Rad) and Mastercycler ep Realplex 2 (Eppendorf) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR reaction (40 cycles) was done on a CFX96 qPCR machine (Bio-Rad) using following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Reactions were performed using the CFX96 real-time PCR detection system (Bio-Rad). The relative gene expression was assessed according to the 2-ΔCt method using flaB2 (LIMLP_09410 ...
-
bioRxiv - Immunology 2024Quote: ... on an iCycler real-time PCR system (Bio-Rad Laboratories, Hemel Hempstead, U.K.), with each sample in triplicate ...
-
bioRxiv - Molecular Biology 2024Quote: ... on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Vienna, Austria). GAPDH was used as a stable housekeeping gene (HKG) ...
-
bioRxiv - Microbiology 2024Quote: ... Thermo Fisher Scientific) on the CFX96 touch Real-Time PCR machine (Bio-Rad) using the following primers at an annealing temperature of 60°C:
-
bioRxiv - Microbiology 2024Quote: Cointegrates quantification was performed using droplet digital PCR (Bio-Rad QX200 droplet-reader). Oligonucleotides were designed by using Primer3Plus program (Figure SUP1) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad) and primers obtained from the Fly Primer Bank listed in Table S1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and performed on a CFX96TM Connect Real-Time PCR System from Bio-Rad. Gene expression levels were normalized to mouse Gapdh expression and changes were determined relative to control cells with significance calculated using the two-way Student’s t-test.
-
bioRxiv - Developmental Biology 2023Quote: ... qRT-PCR reactions were prepared using SsoAdvanced Universal SYBR® Green Supermix (BioRad) and carried out on Real-Time PCR (CFX Opus 96 ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative RT-PCR reactions were performed using iQ SYBR Green Supermix (Bio-Rad) and an CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Pathology 2022Quote: ... and real-time PCR was performed using SYBR Select Master Mix (Bio-Rad) and a CFX384 Touch Real-Time PCR instrument (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real time PCR was performed with iQ SYBR Green Supermix (Bio-Rad, 1708882) using a RealPlex 2 thermocycler (Eppendorf ...
-
bioRxiv - Bioengineering 2022Quote: ... DNase-resistant viral genomic titers were measured using digital-droplet PCR (ddPCR) (BioRad) using with Hex-ITR probes (CACTCCCTCTCTGCGCGCTCG ...
-
bioRxiv - Biochemistry 2022Quote: ... RT-qPCR was performed on CFX Connect Real-Time PCR System (Bio-Rad). Amplification conditions were 95°C for 3 min 1 cycle ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR analysis was conducted on the CFX-Connect 96 system (Bio-Rad) with SYBR Green PCR Master Mix (Cat No ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was performed on the CFX96 Real Time System (Bio-Rad) as described [34] and the housekeeping gene ß-actin was used to correct expression values ...
-
bioRxiv - Microbiology 2023Quote: ... the CFX Connect Real-Time PCR Detection system (Bio-Rad, Hercules, CA, USA) was programmed to run at 95°C for 10 minutes and then to complete 40 cycles of 95°C for 15s (denaturation) ...
-
bioRxiv - Immunology 2022Quote: ... according to manufacturer instructions using a MyiQ real-time PCR system (Bio-Rad). The ΔΔCT method was used to determine relative gene expression using Gapdh as internal controls ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative real-time PCR reactions were performed using SYBR Green Supermix (Bio-Rad). We normalized gene expression level to ribosomal protein L13a (RPL13A ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was done using SsoAdvanced Universal SYBR Green Supermix (1725271, Bio-Rad). Relative gene expression levels were obtained by normalizing the cycle threshold (CT ...
-
bioRxiv - Plant Biology 2022Quote: ... All qRT PCRs were performed in an iCycler system (Bio-Rad, Hercules, USA) with the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR was carried out using the DNA Engine Tetrad 2 (Bio-Rad). Cycling conditions for Zmynd11 RT-PCR were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed on a CFX96 RT-PCR detection system (Bio-Rad) using SYBR Green technology ...
-
bioRxiv - Microbiology 2023Quote: ... All reactions were incubated in the CFX96 Real-Time PCR detection system (BioRad) using the following parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad) using the Luna qPCR Mastermix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the CFX Opus 384 Real-Time PCR System (Bio-Rad, Cat. 12011452). The qpcr primers used in this study are listed in Supplementary Table 12.
-
bioRxiv - Immunology 2023Quote: ... and ran in the CFX Connect Real-Time PCR Detection System (Bio-Rad). The PCR product concentration was determined using the standard curve method65 ...
-
bioRxiv - Cell Biology 2023Quote: ddPCR was carried out using a QX200 Droplet Digital PCR system (Bio-Rad). For the rDNA copy number analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used with the CFX96 Touch Real-time PCR Detection System (Bio-Rad). Samples were run at least in duplicates and normalized to ribosomal protein L32 mRNA according to the ΔΔCt-method (Livak & Schmittgen ...
-
bioRxiv - Neuroscience 2023Quote: ... The reactions were run in Hard-Shell 96-Well PCR Plates (HSP9601, BioRad) on a CFX96 Real Time PCR machine (Bio-Rad ...