Labshake search
Citations for Bio-Rad :
2601 - 2650 of 5406 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was run on a CFX Connect Real-Time PCR Detection System (Bio-Rad), and the qPCR program consisted in an initial step at 95°C for 3 min ...
-
bioRxiv - Plant Biology 2022Quote: ... Effector expression was quantified on the CFX96 real-time PCR detection system (Bio-Rad). Gene expression was calculated using the ΔCT method and normalized against the GlnA housekeeping gene ...
-
bioRxiv - Bioengineering 2022Quote: ... and PCR amplification was done using gene-specific primers with iTaq SYBR green (BioRad) in CFX 96 real-time PCR machine ...
-
bioRxiv - Pathology 2022Quote: ... Quantitative PCR were performed with iTaq™ Universal SYBR® Green Supermix (Bio-Rad) on a CFX384 C1000 Touch (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... Real time PCR was performed using the PrimePCR CSF3 assay qHsaCED0043218 from BIO-RAD. Human RPL13 (Fw ...
-
bioRxiv - Cancer Biology 2022Quote: ... All qPCR experiments were performed in a CFX96 Real Time PCR system (Bio-Rad) and were run in triplicate ...
-
bioRxiv - Immunology 2022Quote: Differential scanning fluorimetry (DSF) was performed using a CFX384 RT-PCR instrument (Bio-Rad). Excitation and emission wavelengths were 587 and 607 nm ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were carried using CFX Connect Real Time PCR Detection System (BioRad; Hercules, CA) as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were added to separate wells of a 48-well PCR plate (Bio-Rad) and incubated in a MiniOpticon Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: RNA abundance was determined by quantitative PCR (qPCR) using iTaq SYBR green (Bio-Rad) with 200 pg of cDNA and 0.25 μM each primer in 10 μL reaction mixtures ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were carried out using the CFX Opus 96 Real-Time PCR System (BioRad). Expression of deGFP was calculated relative to the no acetyl phosphate control.
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was done using the SYBR Green SSo for difficult templates (1725271; Biorad) and a CFX Connect Real Time PCR detection system (788BR01742 ...
-
bioRxiv - Microbiology 2022Quote: ... The reaction was performed on a CFX96 Touch Real-Time PCR System (Bio-Rad) using the following steps ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... Quantitative RT polymerase chain reaction (PCR) was performed using the CFX96 RealTime System (BioRad) with LightCycler FastStart DNA Master plus SYBR Green I (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed on cDNA samples using the iQ SYBRGreen Supermix (Bio-Rad) on a CFX96 Real Time PCR System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR (qPCRs) was carried out using a thermal cycler (model C1000, Bio-Rad) with Platinum Taq DNA polymerase (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... splicing overlap extension PCR was performed using iProof polymerase (Bio-Rad, Hercules, CA, USA) to combine DNA pieces ...
-
bioRxiv - Microbiology 2021Quote: ... The 20 uL PCR mixture contained 1× iTaq Universal SYBR Green Supermix (BIO-RAD), 0.2 uM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR was performed using iQ SYBR Green Supermix (BioRad, Hercules, CA) on a C1000 Thermal cycler equipped with a CFX96 Real-Time PCR system using BioRad CFX Manager 3.1 Software ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using iTaq SYBR Green Supermix (Bio-Rad; 172-5121) with a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR was performed using a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Actb and Gapdh were used for normalization controls.
-
bioRxiv - Microbiology 2019Quote: ... mRNA abundance was measured by quantitative PCR (qPCR) using iTaq SYBR green (Bio-Rad) on an Applied Biosystems 7500 with 400 pg of cDNA and 0.25 µM each primer in 10 µL reactions ...
-
bioRxiv - Plant Biology 2021Quote: ... amiRNA constructs were cloned by overlap extension PCR with iProof High Fidelity polymerase (BioRad), following a protocol published on the Web MicroRNA Designer website ...
-
bioRxiv - Plant Biology 2021Quote: ... and the CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... Amplification was performed on the CFX Connect Real-Time PCR Detection System thermocycler (BioRad) using the following thermal cycling program starting with 3 min at 95 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Using the Bio-Rad® CFX96 Real-time PCR system (Bio-Rad®, USA), cycling parameters were as follows ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: qPCR was run on a CFX96 Touch Real-Time PCR detection system (Bio-Rad) with SYBR Green qPCR Kit (#F415S ...
-
bioRxiv - Microbiology 2020Quote: ... and analysis were performed with the CFX96TM real time PCR detection system (Bio-Rad). A calibration curve to assess the sporozoite numbers in the mosquito inoculation samples was generated by analysing skin samples injected with a dilution range of sporozoites (2-step dilution ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Quantitative real-time PCR was performed using iQ Universal SYBR Green Supermix (Bio-Rad) with the specific sense and anti-sense primers for ATP6V1B1 (forward ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were prepared in a 96-well plate (Bio-Rad, CA, USA). The plate was placed on a AutoDG (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... 16 µl PCR mix (containing 10 µl SYBR green mix (2x) (BioRad, Hercules, USA), 0.6 µl forward and reverse gene-specific primer (10 µM ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR reaction contained 10 μL of 2x QX200 ddPCR EvaGreen Supermix (Bio-Rad), 100 nM forward primer (CTTCTTGCATTCTCCTCATTTCCTC ...
-
bioRxiv - Zoology 2021Quote: ... PCR products were photographed using a Gel Doc™ XR+ System (Bio-Rad®).
-
bioRxiv - Developmental Biology 2022Quote: ... and quantitative PCR was done using Eva Green chemistry (BioRad Laboratories Inc., CA, USA) in the CFX96 Real-Time PCR System (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... Amplifications were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad) and Bio-Rad CFX Manager 3.1 software ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Reactions were amplified using a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) with the following PCR cycling conditions ...
-
bioRxiv - Genomics 2022Quote: ... Droplets were then individually scanned using the QX200 Droplet Digital PCR system (Bio-Rad). To generate the standard curve ...
-
bioRxiv - Immunology 2022Quote: ... and carried out in the CFX384 Touch™ real-time PCR detection system (BioRad). The details of primers used are listed in Table S2.
-
bioRxiv - Genetics 2022Quote: ... was used to perform real-time PCR on an iCycler iQ system (Bio-Rad) with promoter-specific primers (Supplementary Table-1).
-
bioRxiv - Genetics 2022Quote: ... following manufacturer instructions on a Bio-Rad CFX96 Real-Time PCR system (Bio-Rad). If not processed immediately ...
-
bioRxiv - Cell Biology 2022Quote: ... and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad) and the following oligonucleotides ...
-
bioRxiv - Pathology 2019Quote: ... Quantitative PCR was performed with iTaq™ Universal SYBR® Green Supermix (Bio-Rad) on ViiA 7 Real-Time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2019Quote: ... 25 PCR amplification cycles were set using the T100 Thermal Cycler (BioRad, Milan, Italy) thermocycler ...
-
bioRxiv - Genetics 2019Quote: ... Reactions were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad) using the following conditions ...
-
bioRxiv - Cancer Biology 2019Quote: ... in CFX Connect™ Real-Time PCR detection System (BIO-RAD, Hercules, CA, USA) with the following thermal profile – 1 cycle ...
-
bioRxiv - Microbiology 2019Quote: ... PCR product was amplified in a DNA Engine Thermal Cycler (Bio-Rad, Sydney, Australia) and electrophoresed on a 1% agarose gel ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: RT-qPCR was performed on CFX96™ Real-Time PCR Detection System (Bio-Rad). All reactions were performed in triplicates in a total volume of 20 μl each using TaqMan® Universal PCR Master Mix (Applied Biosystems-Life Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... The RT-PCR was performed using S1000™ Thermal Cyclers (Bio-Rad; Hercules, CA) using the following cycling program ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Quantitative real-time PCR was performed using iQ Universal SYBR Green Supermix (Bio-Rad) with the specific sense and anti-sense primers for TFEB (forward ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Reactions were incubated in a CFX96 Touch Real-Time PCR detection system (Bio-Rad) by the following program ...