Labshake search
Citations for Bio-Rad :
2201 - 2250 of 5108 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The mixtures were prepared in 96-well microtiter PCR plates (Bio-Rad Laboratories), sealed with an adhesive cover (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplifications were conducted in a T100™ Thermal Cycler (Bio-Rad, U.S.A.) as previously described (Wang et al ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were amplified in a BioRad T-100 Thermocycler (Bio-Rad Laboratories) with initial denaturation at 94°C for 2 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was performed on a T100 Thermal Cycler (Bio-Rad Laboratories Ltd, UK) with the following profile ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was conducted on a T100 thermocycler (Bio-Rad, Hercules, CA, USA) under the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... The culture dishes were sealed with a transparent PCR plate film (Bio-Rad) and maintained in a multi-channel luminometer LumiCycle (Actimetrics ...
-
bioRxiv - Neuroscience 2022Quote: ... with a TaqMan RT-PCR instrument (CFX384 real time system, Bio-Rad Laboratories). After the initial retrotranscription step ...
-
bioRxiv - Physiology 2023Quote: ... on a CFX-96 real-time polymerase chain reaction (PCR) machine (Bio-Rad). The relative expression of each mRNA was calculated and normalized to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... We ran plates on a CFX384 Touch Real-Time PCR detection system (BioRad) under the following thermocycling protocol ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was carried out in a MyiQ2 thermal cycler (Bio-Rad, USA) using a SYBR Green PCR premix kit (SparkJade ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantitative PCR was carried out using the CFX96 Real Time System (Bio-Rad) as described [75] ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR amplification was carried out in a T100 thermal cycler (Bio-Rad). The thermal consisted of initial denaturation at 95°C for 5 min followed by 40 cycles of 95°C for 30 s (denaturation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplification was performed using a CFX96 Touch Real-Time PCR Detection System (BioRad). Primers used for amplification were ...
-
bioRxiv - Molecular Biology 2022Quote: ... and qRT-PCR was performed using the iQ SYBR green supermix (Bio-Rad) in 96-well plates.
-
bioRxiv - Systems Biology 2022Quote: ... Iodixanol-purified AAVs were quantified using droplet digital PCR (ddPCR, (Bio-Rad, Berkeley) using QX200 ddPCR EvaGreen Supermix (Cat# 1864034 ...
-
bioRxiv - Zoology 2022Quote: ... Quantitative PCR (qPCR) was performed with iTaq Universal SYBR Green Supermix (Bio-Rad). The 20 μL reaction mixture consisted of 10 μL Supermix ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The qPCR was performed on CFX96 Touch Real-Time PCR Detection System (BioRad). The thermocycling program was the following ...
-
bioRxiv - Microbiology 2022Quote: The QX200™ Droplet Digital™ PCR system (ddPCR, Bio-Rad Laboratories, Inc.) was used to generate droplets and read the results following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... For qPCR analysis CFX96 Real-Time PCR Detection System (BioRad, Hercules, CA, USA) was employed using RNA expression of target genes relative to β-actin was quantified by 2ΔΔCT method ...
-
bioRxiv - Cancer Biology 2022Quote: All qPCR was performed using a CFX96 Touch Real-Time PCR System (BioRad).
-
bioRxiv - Plant Biology 2022Quote: ... All qRT PCRs were performed in an iCycler system (Bio-Rad, Hercules, USA) with the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR was carried out using the DNA Engine Tetrad 2 (Bio-Rad). Cycling conditions for Zmynd11 RT-PCR were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed on a CFX96 RT-PCR detection system (Bio-Rad) using SYBR Green technology ...
-
bioRxiv - Microbiology 2023Quote: ... All reactions were incubated in the CFX96 Real-Time PCR detection system (BioRad) using the following parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad) using the Luna qPCR Mastermix (New England Biolabs ...
-
bioRxiv - Pathology 2022Quote: ... and real-time PCR was performed using SYBR Select Master Mix (Bio-Rad) and a CFX384 Touch Real-Time PCR instrument (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real time PCR was performed with iQ SYBR Green Supermix (Bio-Rad, 1708882) using a RealPlex 2 thermocycler (Eppendorf ...
-
bioRxiv - Bioengineering 2022Quote: ... DNase-resistant viral genomic titers were measured using digital-droplet PCR (ddPCR) (BioRad) using with Hex-ITR probes (CACTCCCTCTCTGCGCGCTCG ...
-
bioRxiv - Biochemistry 2022Quote: ... RT-qPCR was performed on CFX Connect Real-Time PCR System (Bio-Rad). Amplification conditions were 95°C for 3 min 1 cycle ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR analysis was conducted on the CFX-Connect 96 system (Bio-Rad) with SYBR Green PCR Master Mix (Cat No ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was performed on the CFX96 Real Time System (Bio-Rad) as described [34] and the housekeeping gene ß-actin was used to correct expression values ...
-
bioRxiv - Microbiology 2023Quote: ... the CFX Connect Real-Time PCR Detection system (Bio-Rad, Hercules, CA, USA) was programmed to run at 95°C for 10 minutes and then to complete 40 cycles of 95°C for 15s (denaturation) ...
-
bioRxiv - Immunology 2022Quote: ... according to manufacturer instructions using a MyiQ real-time PCR system (Bio-Rad). The ΔΔCT method was used to determine relative gene expression using Gapdh as internal controls ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative real-time PCR reactions were performed using SYBR Green Supermix (Bio-Rad). We normalized gene expression level to ribosomal protein L13a (RPL13A ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was done using SsoAdvanced Universal SYBR Green Supermix (1725271, Bio-Rad). Relative gene expression levels were obtained by normalizing the cycle threshold (CT ...
-
bioRxiv - Neuroscience 2023Quote: ... The reactions were run in Hard-Shell 96-Well PCR Plates (HSP9601, BioRad) on a CFX96 Real Time PCR machine (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used with the CFX96 Touch Real-time PCR Detection System (Bio-Rad). Samples were run at least in duplicates and normalized to ribosomal protein L32 mRNA according to the ΔΔCt-method (Livak & Schmittgen ...
-
bioRxiv - Immunology 2023Quote: ... and iTaq SYBR green (Accuscience) on an iCycler PCR machine (Bio-Rad Laboratories). Data was normalized to the endogenous control 18S rRNA and expressed as fold change relative to controls.
-
bioRxiv - Immunology 2023Quote: ... the 96-well PCR plate was loaded on the droplet reader (Bio-Rad) and the analysis was performed with QuantaSoft analysis software (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Amplicons were detected in a CFXConnect Real-Time PCR Instrument (Bio-Rad Laboratories). Cq values were calculated using LinRegPCR after correcting for amplicon efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by SYBR green quantitative real-time PCR (Bio-Rad Laboratories, Hercules, CA). Relative changes were quantified using the comparative cycle threshold method (2−ΔCT) ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was conducted with the CFX96 real-time system from Bio-Rad using the SsoFast EvaGreen Supermix with Low ROX (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ddPCR was carried out using a QX200 Droplet Digital PCR system (Bio-Rad). For the rDNA copy number analysis ...
-
bioRxiv - Microbiology 2023Quote: ... The real time PCR analysis was achieved with an i-Cycler (BIO-RAD) using the following reaction conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the CFX Opus 384 Real-Time PCR System (Bio-Rad, Cat 12011452). Data were presented as the percentage of input ...
-
bioRxiv - Cancer Biology 2023Quote: ... and qRT-PCR was subsequently performed using IQ SYBR green mix (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... and conducted in a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Three technical replicates were performed for each of the three biological replicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad) on a CFX384 RT-PCR detection system (Bio-Rad).
-
bioRxiv - Cell Biology 2023Quote: ... in 384-well plates and a CFX384 real time PCR system (Bio-Rad). Each sample consisted of 10 µl of a master mix containing 5.5 µl of SYBR Green ...
-
bioRxiv - Microbiology 2023Quote: ... Data was collected on a CFX384 Touch Real-Time PCR machine (Bio-Rad), and quantification cycle (Cq ...