Labshake search
Citations for Bio-Rad :
2101 - 2150 of 2823 citations for 9 10 12 13 tetrahydroxyoctadecanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of each sample was loaded into a well of a 10% Mini-PROTEAN TGX Precast Gel (Bio-Rad). Gels were transferred to PVDF membranes (Merck KGaA ...
-
bioRxiv - Genomics 2022Quote: Slot blot was performed using 1.5 ng of gDNA that was denatured in 400 mM NaOH/10 mM EDTA and blotted onto nitrocellulose membrane (BioRad) in duplicate for dsDNA and 5mC DNA using a slot blot apparatus (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Cell Biology 2019Quote: ... were boiled for 5 min and then loaded into 10% Mini-Protean TGX (Tris-Glycine eXtended) Stain-Free precast Gels (Biorad). Electrophoresis was performed in a buffer containing 25 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on a 10% SDS-polyacrylamide gel and then transferred to a nitrocellulose membrane (BioRad, Boston, MA, USA). The membrane was incubated with the appropriate primary antibody and then incubated with a species-appropriate secondary antibody ...
-
A gut-secreted peptide controls arousability through modulation of dopaminergic neurons in the brainbioRxiv - Neuroscience 2020Quote: ... DNA product was diluted 1:10 and used to set up quantitative PCR reactions using Sybr Green (Biorad #170-8880). Primers were obtained from ID Technologies:
-
bioRxiv - Immunology 2020Quote: The VSGm protein samples were separated on 10% SDS-PAGE then trans-blotted onto two separate nitrocellulose membranes using the mini PROTEAN II Trans-blot unit (Biorad). The membranes were rinsed in 1x PBS (0.1% w/v ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μg total protein was separated on 10% SDS-PAGE gels and blotted onto Immun-Blot PVDF membrane (Bio-Rad). LSD1-GFP ...
-
bioRxiv - Physiology 2021Quote: ... Approximately 10 µg of protein was loaded into a 4% - 20% Criterion pre-cast gel (Bio-Rad, Hercules, CA, USA) and resolved at 120 V for 120 min ...
-
bioRxiv - Microbiology 2020Quote: ... brucei were separated by SDS-PAGE (8% or 10%) and immunoblotted on TransBlot Turbo Midi-size PVFD Membranes (Bio-Rad) (48) ...
-
bioRxiv - Neuroscience 2021Quote: ... We ran 40 µg of protein on 10% gels using the Mini-PROTEAN Tetra Cell western blotting system (Bio-Rad). Anti-NaV1.1 (Ab5204a ...
-
bioRxiv - Biochemistry 2020Quote: ... samples corresponding to equal amounts of protein were separated on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane by the wet tank blot method (BioRad, according to manufacturer’s instructions) ...
-
bioRxiv - Biochemistry 2020Quote: The protein storage buffer for purified Pol IV and Pol IVT120P was exchanged to 10 mM potassium phosphate (pH 7.5) with Micro Bio-Spin P-30 Chromatography Columns (Bio-RAD) right before the measurements ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were then sonicated and heated to 95 °C for 10 minutes prior to being evenly loaded onto SDS-polyacrylamide gels using the Mini Trans-Bot electrophoresis system (Biorad), followed by transfer to PVDF using standard western blotting procedures.
-
bioRxiv - Neuroscience 2022Quote: ... protein samples (10-30 μg) were boiled and separated on precasted 4-20% Criterion TGX Stain-free gels (Bio-Rad) and transferred to a nitrocellulose membrane (Amersham Protran 0.2um NC ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR reaction was carried out in 10 μl volume with 5 μl of 2X iTaq Universal Sybergreen Supermix (BioRad), 500 nM of forward and reverse primers (for promoter ...
-
bioRxiv - Microbiology 2022Quote: ... rinsed 3x with DI water 10 minutes each and stained overnight with agitation in QC colloidal Coomassie stain (Bio-Rad). The gel was rinsed with DI water 3x for 10 min and imaged using a ChemiDoc Touch Imaging System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 or 12.5% bis-tris gels and protein was transferred to PVDF membranes using a wet transfer system (Bio-Rad). Membranes were blocked with 5% milk in TBS-T and incubated overnight with primary antibody in either milk or BSA at manufacturer recommended concentrations ...
-
bioRxiv - Cell Biology 2022Quote: All proteins were snap frozen in single-use aliquots and protein purity was assessed by 10% SDS-PAGE (BioRad Laboratories) and stained with Coomassie Brilliant Blue (Supplemental Figure S1).
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biochemistry 2019Quote: ... The DNA recovery from this sample applied Chelex 100 Resin (Bio-Rad, 10% w/v in 500 μL in ddH2O) with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA samples were fragmented for 10 minutes on ice in 0.2 N NaOH and purified on Bio-Spin P30 columns (Bio-Rad). Biotin-labelled RNA was then purified using MyOne Streptavidin C1 Dynabeads (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2019Quote: ... Triplicate PCR reactions were performed in 20 µl final volume with 10 ng of fragmented gDNA using the ddPCR Supermix for Probes (No dUTP) master mix (Biorad) with 11-11 pmol primers and 50-50 pmol of TaqMan probes (for sequences of primers and probes see Table 1 below) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Supernatants were analyzed on 10 % (w/v) SDS-PAGE gels with a Miniprotean III electrophoresis system (Bio-Rad; CA, USA). For western-blots ...
-
bioRxiv - Molecular Biology 2019Quote: ... Subsequent gel exclusion chromatography of loaded liposomes over a 10 mL BioGel A-0.5 M agarose resin (BioRad 151-0140) revealed no detectable AmB in the salt volume and essentially all of the AmB was retained by liposomes ...
-
bioRxiv - Plant Biology 2019Quote: ... Equal amounts of the eluted proteins were separated on 10% SDS-PAGE gels and blotted onto PVDF membranes (Bio-Rad). GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... Equal amounts of the eluted proteins were separated on 10% SDS-PAGE gels and blotted onto PVDF membranes (Bio-Rad). GFP- and RFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000 ...
-
bioRxiv - Biochemistry 2019Quote: ... 10% of 2 mM EGTA eluates were concentrated and separated on 4%– 20% gradient SDS-polyacrylamide Tris-glycine gels (Biorad). Total protein content was visualized by silver staining ...
-
bioRxiv - Molecular Biology 2019Quote: ... SDS-PAGE gels used for this work were 10 % final concentration made with 30 % acrylamide/bis solution at a ratio of 37.5:1 (BioRad 1610158). Please note that SDS-PAGE analysis does not resolve polyP-induced shifts ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Cell Biology 2019Quote: ... Typically 10-25 μg total protein was separated on reducing SDS-PAGE (4-15% or 4-20% gradient gels, BioRad). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Developmental Biology 2019Quote: ... Homogenates were centrifuged (11,000 rpm, 10 min, 4°C) and resultant supernatant assayed using a DC Protein Assay Kit (Bio-Rad). A total of 20 μg of sample was loaded per well onto 12% SDS-PAGE gels and subsequently transferred overnight at 4°C to Immun-Blot LF PVDF membranes (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: One hundred μg of the different PAO1 cytoplasmic extracts were loaded onto conventional SDS-PAGE 10% Bis-Tris gels (mini-protean TGX Stain-free precast Gels, BioRad). The gel was stained with Coomassie blue and each lane was cut into 10 bands ...
-
bioRxiv - Physiology 2020Quote: ... 10-25 µg of total protein was loaded in a 15-well pre-casted gradient gel (Bio-rad, 456-8086). After electrophoresis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 or 10 μL of the supernatant were resolved on an Any kD TGX Stain-Free protein gel (4568126, BioRad) alongside a Chameleon Duo Pre-Stained Protein Ladder (928-60000 ...
-
bioRxiv - Physiology 2020Quote: ... The supernatant was collected following centrifugation at 8,000g for 10 min and protein concentrations were determined in triplicate using the Bradford method (Bio-Rad). Ten micrograms of protein were subjected to SDS-PAGE on 4–20% Criterion TGX Stain-Free Protein Gel (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 10 min at 21,000 × g at 4°C and Bio-Rad protein assay reagent (Bio-Rad) was used to determine the protein concentrations of lysates ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were washed twice with 1x lysis buffer plus 10 mM imidazole before loading onto a disposable column (Bio-Rad). After two washes (lysis buffer plus 25 mM imidazole) ...
-
bioRxiv - Microbiology 2019Quote: ... according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad). cas9 mRNA and 16srRNA were analyzed with the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were heated at 90°C for 10 minutes and loaded onto a 4-20% precast polyacrylamide gel (BioRad). The gel was stained with SimplyBlue SafeStain (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... gels (4.5% acrylamide stacking gel and 10% acrylamide resolving gel) and were then transferred to 0.45 µm nitrocellulose membranes (Bio-Rad) using a semi-dry transfer system (Trans-Blot Turbo ...
-
bioRxiv - Biochemistry 2019Quote: ... Gels were then incubated in distilled water for 10 minutes and visualized by UV transillumination (Bio-Rad ChemiDoc Imaging System). The results were quantified by ImageJ software (Schneider et al. ...
-
bioRxiv - Immunology 2021Quote: ... Excess biotin was removed via size exclusion chromatography using an Enrich SEC 650 10 x 300 mm column (Bio-Rad). The S-2P probes were made at a ratio of 2 moles of trimer to 1 mole streptavidin ...
-
bioRxiv - Genetics 2019Quote: ... Protein samples were denatured at 95°C for 5 min in appropriate loading buffer and loaded into precast SDS-PAGE gels (10% polyacrylamide; Biorad). Gels were run at 40 mA for 45 min in 1x running buffer (Fisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μl of 10-fold diluted cDNAs was used for qRT-PCRs using a CFX96 real-time PCR machine (BioRad) with a SYBR solution (Eurogentec ...
-
bioRxiv - Neuroscience 2019Quote: ... conjugated secondary antibody (1:10 000) was subsequently applied and visualized by reaction with chemiluminesence reagent (Clarity Western Blotting Substrates Kit, BioRad) on radiography film (Carestream Blue X-ray film).
-
bioRxiv - Cancer Biology 2019Quote: ... The denatured samples were loaded onto a 10% Tris-Glycine SDS-polyacrylamide gel (Bio-Rad Cat# 456-1024, Hercules, CA). Protein molecular weight marker (Bio-RAD Cat# 161-0374 ...
-
bioRxiv - Genetics 2020Quote: ... Animals were electroporated at 300 V for 10 ms (unless otherwise specified) by square-wave single pulse using a Bio-Rad Gene Pulser (BioRad). Immediately after the electroporation ...
-
bioRxiv - Neuroscience 2021Quote: ... The blots were then washed 3x with TBS-T for 10 min each and incubated with the horseradish peroxidase (HRP) conjugated specific secondary antibodies (1:20,000, Bio-Rad) for 1 h at RT ...
-
bioRxiv - Biochemistry 2021Quote: The 100µl plasma was inactivated by heating at 56°C for 30 min 10 .60µl plasma was used for albumin and globulin depletion using an Aurum serum mini kit (BioRad, USA). The six depleted plasma samples were used for SWATH-MS analysis ...