Labshake search
Citations for Bio-Rad :
1851 - 1900 of 4928 citations for 6H Purin 6 one 1 2 3 9 tetrahydro 3 methyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Unreacted free dye was removed using P-6 Gel Columns (Bio-Rad). The labeling efficiency is about 1 Alexa Fluor 647 dye per antibody ...
-
bioRxiv - Biophysics 2019Quote: ... and purified using size exclusion chromatography (Micro Bio-Spin 6, Bio-Rad). The column purification was performed three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ethanol precipitation followed by P-6 Micro Bio-Spin Columns (Bio-Rad) were employed to remove unconjugated dyes.
-
bioRxiv - Genomics 2022Quote: ... purified on a Micro-Bio Spin P-6 Gel Column (Bio-Rad)and subsequently annealed to 5 µg of RNA extract ...
-
bioRxiv - Microbiology 2023Quote: ... for up to 6 h and imaged with the ChemiDoc (Bio-Rad). Signal intensities were quantified in ImageLab (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... and a 6-Plex Mouse Cytokine Panel (Bio-Rad Laboratories; Hercules, California). Insulin-like growth factor 1 (IGF-1 ...
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad). The concentration of the protein was determined by using the absorption measured at 280 nm and the corresponding extinction coefficient of 20970 M-1cm-1.
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... using two cycles of spin gel-filtration (MicroBioSpin P-6, Bio-Rad). The complex was subsequently diluted by 20 mM AA to 0.5 µM (estimated based on 3+3 stoichiometry) ...
-
bioRxiv - Biochemistry 2024Quote: ... a calibration curve was created using Microplate Manager® 6 (Bio-Rad) to calculate the intracellular SAM concentration.
-
bioRxiv - Microbiology 2024Quote: ... All assays were desalted by Micro Bio-Spin 6 columns (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... Unincorporated nucleotides were removed by Micro Bio-Spin 6 columns (Bio-Rad) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were run in a 2% agarose slab gel and stained with ethidium bromide for visualization by UV shadowing (Bio-Rad Molecular Imager Gel Doc XR+).
-
bioRxiv - Molecular Biology 2020Quote: ... The free and bound RNA bands were quantified using Quantity One software (Bio-Rad, Hercules, CA) and fit with the Hill equation in Prism.
-
bioRxiv - Biophysics 2019Quote: ... and quantitated by densitometry using a DNA standard curve and Quantity One® software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of the images was performed using Quantity one and Gel doc XR from Biorad (Hercules).
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were quantified by densitometric analysis of the fluorograms (Quantity One software; Bio-Rad, Hercules, CA) obtained in the linear range of the emulsion response.
-
bioRxiv - Microbiology 2021Quote: ... Multiplex RT-qPCR assay were carried out using Reliance One-Step Multiplex RT-qPCR Supermix (BioRad) or LightCycler Multiplex RNA Virus Master (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were quantified by densitometry analysis using the Bio-Rad Quantity One software (Bio-Rad). Fragments were pooled in an equimolar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colony counting was performed using a Gel Doc Documentation System and Quantity One software (Bio-Rad) and quantification using Excel software.
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometric analysis was performed using Bio-Rad Quantity One software version 4.3.0 (Bio-Rad Laboratories, Inc.).
-
bioRxiv - Neuroscience 2020Quote: ... and protein immunoreactive bands quantified (Quantity One densitometry software or Image Lab software from Bio-Rad). WB data is presented as fold-increases of a control condition (stated in figure caption) ...
-
bioRxiv - Bioengineering 2019Quote: One hundred microliters of polyacrylamide resin containing different ratios of 40% acrylamide (Bio-Rad 161-0140) and 2%bis-acrylamide (Bio-Rad 161-0142 ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of RNA was converted to cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad). Primers for A1/A2 transcripts were ordered directly from Liddelow et al28 ...
-
bioRxiv - Microbiology 2021Quote: ... quantitative RT-PCR was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and the CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RT-qPCR was performed using iTaq Universal One-Step RT-qPCR Kits (Bio-Rad, cat.# 1725150). RT-qPCR primers were designed using Primer359 and are listed in Supplementary Table 13 ...
-
bioRxiv - Immunology 2021Quote: ... Products were analyzed by agarose gel electrophoresis in a ChemiDoc XRS-Quantity One Image Analyzer (BioRad)
-
bioRxiv - Cancer Biology 2022Quote: The protein expression was assayed and densitometric analysis was performed using quantity one software (Bio-Rad) as reported previously (11) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... one microgram of isolated RNA was reverse transcribed using the iScript™ cDNA Synthesis Kit (BioRad). Using the DyNAmo HS SYBR green qPCR kit (F-410L ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fraction bound was determined by densitometry of raw data using Quantity One® (v4.6.7, Bio-Rad) and the following equation for specific bands and then normalized ...
-
bioRxiv - Zoology 2022Quote: gRNA was quantified by RT-qPCR using the iTaq Universal probe one-step kit (Bio-Rad) with primers and probe targeting the DENV2 envelope [27] ...
-
bioRxiv - Plant Biology 2023Quote: ... One µg of RNA was reverse-transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad). Real-time quantitative PCR was performed in a final volume of 5 µl including 10% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using the iTaqUniversal SybrGreen one-step kit (BioRad, Hercules, Ca, USA) according to the manual protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Densitometry analysis was performed using Bio-Rad Quantity One image analysis software (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time PCR was performed on CFX97 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... with visualization on a Personal Molecular Imager FX scanner and analysis with Quantity One software (BioRad).
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR reactions were performed using the iTaq Universal Sybr green One-step kit (Bio-Rad) with the following reaction mix per sample ...
-
bioRxiv - Physiology 2024Quote: ... One μg of total RNA was reverse-transcribed as per the manufacturer’s instructions (VWR and BioRad). The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... iTaq Universal SYBR Green One step RT-PCR kit (cat# 1725150) was purchased from Bio-Rad. Mature miR-146a (cat# YP00204688) ...
-
bioRxiv - Neuroscience 2024Quote: ... was used for signal detection and densitometric analyses were performed using the Quantity One software (Biorad).
-
bioRxiv - Bioengineering 2020Quote: ... quantification was performed using a Bio-Rad Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 65 °C ...
-
bioRxiv - Bioengineering 2020Quote: ... Chromatographic separation was performed using a Rezex Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 55 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Chromatographic separation was performed using a Bio-Rad Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 65 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Chromatographic separation was performed using a Bio-Rad Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 65 ℃ ...