Labshake search
Citations for Bio-Rad :
2051 - 2100 of 4928 citations for 6H Purin 6 one 1 2 3 9 tetrahydro 3 methyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... One half microgram of total RNA was reverse transcribed into cDNA using an iScript cDNA Synthesis kit (Bio-Rad, 1708891). All TaqMan primers and probes were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... One µg of total RNA was used for first-strand cDNA synthesis with the iScript cDNA Synthesis Kit (Bio-Rad) and diluted 8 times afterwards ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA levels were determined by TaqMan one-step qRT-PCR on a CFX96 Touch Real-Time PCR Detection System (BioRad) using standard cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following qRT-PCR thermocycling protocol was used with the iTaqTM universal SYBR® Green One-Step kit (Bio-Rad): 95 °C for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The reaction mixture was separated on SDS-PAGE and the phosphorylated receptor was autoradiographed for image analysis with the Quantity One program (BioRad) on phosphor screens.
-
bioRxiv - Cancer Biology 2022Quote: ... A total of one μg of total RNA was used for reverse transcription with iScript cDNA synthesis kit (Bio-Rad). Real-time PCR was performed using SYBR Green PCR Master Mix (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... One μg of RNA was used to perform the reverse transcriptase reaction with iScript TM cDNA Synthesis Kit (Bio-Rad). Changes in mRNA levels of the target genes were determined by relative RT-qPCR with a CFX96TM Real‒Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Bioengineering 2023Quote: ... 200 ng of purified RNA was immediately reverse transcribed at 37 °C for one hour in an S1000 Thermal Cycler (BioRad) via the OmniScript RT Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time RT-qPCR was performed using the AB StepOnePlus Detection System and the one-step kit RT-PCR Master Mix Reagents (#64471423, Biorad). Reaction mixtures were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Transcripts were measured by TaqMan one-step qRT-PCR on a CFX96 Touch real-time PCR detection system (Bio-Rad) and were reported as relative differences in threshold cycle (Ct ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 100ng of RNA was used with iTaq™ Universal SYBR® Green One-Step Kit (Bio-Rad, CA, USA) to perform a one-step RT-qPCR in a volume of 20 μl using a QuantStudio3 real-time PCR instrument from ThermoFisher (Waltham ...
-
bioRxiv - Bioengineering 2024Quote: ... The proteins were incubated for one hour at 65 and 70°C in a thermocycler with heated lid (T100, BioRad) Binding to D25 and MPE8 antibodies was measured afterwards following the protocol described above.
-
bioRxiv - Cancer Biology 2024Quote: ... Conversion of one µg of RNA into cDNA was performed using the iScript cDNA Synthesis Kit (1708890; Bio-Rad Laboratories) and Master Cycler Pro Device (EPPE6324000.516 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Plant Biology 2020Quote: ... One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) using the iScript cDNA Synthesis Kit (Biorad, Hercules, California) in a 20 μL reaction volume ...
-
bioRxiv - Genetics 2021Quote: ... The gel was stained after the electrophoresis with SYBR Safe dye (10000x) and visualized using Quantity One analysis software (Bio-rad).
-
bioRxiv - Microbiology 2021Quote: ... the membranes were washed 3 times with 1 x TBS-T and antibody binding was detected in a BioRad Versa Doc System with the Quantity One software (BioRad, Germany) by chemiluminescence using the Clarity Western ECL Substrate (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were washed thrice with TBS-T before incubation for one hour at room temperature with secondary antibodies (horse radish peroxidase goat anti-mouse or anti-rabbit; Bio-Rad), all at 1:5000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... ZIKV RNA was quantified by TaqMan one-step qRT-PCR using a CFX96 Touch real-time PCR detection system (Bio-Rad). Genome copies per mL of serum on a log10 scale was determined by comparison with a standard curve generated by using serial 10-fold dilutions of a ZIKV plasmid and previously reported primers ...
-
bioRxiv - Genetics 2020Quote: cDNA synthesis was performed with one μg of total RNA in 20 μl reactions using the iScript Reverse Transcription Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Additional one-ml samples were used for total protein determination using the Bio-rad Protein Assay kit (Bio-rad, CA, USA). β-galactosidase assays were performed as described previously (38) ...
-
bioRxiv - Microbiology 2021Quote: ... using the primer-probe mix from the 2019-nCoV RUO kit (IDT) with iTaq Universal Probes One-Step kit (Bio-Rad). The 2019-nCoV_N_Positive Control plasmid (IDT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SYBR Green qPCR was performed using a ViiA7 (A&B Biosystems, Waltham, MA) with iTaq Universal SYBR Green One Step Kit (BioRad, #1725151) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... All gene transcripts were quantified by quantitative PCR using qScriptTM One-Step qRT-PCR Kit (Quanta Biosciences, #95057-050) on CFX96 real-time PCR system (Bio-Rad). Primer sequences for qPCR were as follow ...
-
bioRxiv - Neuroscience 2022Quote: One ng of total RNA was used for single-tube reverse transcription (RT) and ddPCR using the One-Step RT-ddPCR Advanced kit (Bio-Rad). Droplets were generated and subsequently analyzed using the QX100 system (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of total RNAs was used to generate cDNA using the iScript cDNA synthesis kit (Bio-Rad, Richmond, CA, USA). Real-time PCR was subsequently performed using the iTaq Universal SYBER Green Supermix using the primers listed in Supplemental Table 1 on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... membranes were incubated with secondary antibodies for one hour at room temperature and developed using Clarity ECL Detection Kit (Bio-Rad).
-
bioRxiv - Cell Biology 2019Quote: ... was performed using 300 ng RNA with the CFx Connect Real-Time system with the iTaq Universal SYBR Green One Step Kit (Bio-Rad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was cleared by centrifugation at 21000 g for 5 min at 4°C and supernatant was mixed with one-third volume 4X Laemmli Sample Buffer (Bio-Rad). For lysozyme lysis ...