Labshake search
Citations for Bio-Rad :
101 - 150 of 1482 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Systems Biology 2021Quote: ... followed by 15 s at 95 °C and 60 s at 58 °C for 40 cycles using Biorad CFX384 thermocycler (Biorad). The mRNA levels of genes encoding cytokine expression were normalized relative to the mean levels of the housekeeping gene and compared using the 2−ΔΔCt method as described previously2 ...
-
bioRxiv - Systems Biology 2020Quote: ... reverse transcription for 20 mins at 46 °C and inactivation for 1 min at 95 °C) in a thermal cycler (C1000 Touch, Biorad). TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Systems Biology 2020Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad).
-
bioRxiv - Microbiology 2020Quote: ... 73105b and 73106f pseudotyped viruses were incubated at temperatures from 37°C to 50°C for 60 minutes using temperature gradient on PCR thermal cycler (BioRad). Pseudoviruses were then aliquoted in a 96-well culture plate ...
-
bioRxiv - Biophysics 2022Quote: ... The protein sample was incubated at 40°C and 80 °C respectively for 1 h in a PCR cycler (BioRad) with a heated lid to prevent evaporation ...
-
bioRxiv - Neuroscience 2022Quote: ... then denatured for 5 min at 95°C and annealed by gradual cooling down at −0.1 °C/sec using a PCR thermocycler (BioRad T100). Annealed oligos were subsequently inserted into BbsI-digested vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) ...
-
bioRxiv - Biophysics 2022Quote: ... The mixture was then heated up to 95°C for 5 minutes and cooled down to 30°C at the rate of 1°C per minute using a thermal cycler (BioRad).
-
bioRxiv - Zoology 2022Quote: ... and folded by heating to 95°C for 2 min and slowly cooling down at 0.1 °C per second using a thermocycler (Bio-Rad). DsRNA concentrations were adjusted to 3 or 14 μg / μl using SpeedVac Concentrator (Thermo Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... using 45 cycles of 15 s at 95°C and 30 s at 60°C in a CFX96 cycler (Biorad). Primers are listed in Additional file 1.
-
bioRxiv - Plant Biology 2024Quote: ... using 45 cycles of 15 sec at 95°C and 30 sec at 60°C in a CFX96 cycler (Biorad). Data were normalized to the transcript encoding PP2A subunit A3 (At1g13320 ...
-
bioRxiv - Neuroscience 2024Quote: ... 72°C (30s) and 1 cycle of 72°C for 5 min (C1000 Touch Thermal Cycler, Bio-Rad, Hercules, CA). 2–5 μl of the PCR reactions were subjected to gel electrophoresis using a 3% agarose gel in tris-borate-ethylenediamine tetraacetic acid buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The prepared assay plate was exposed to temperature increases from 25 ⁰C to 95 ⁰C with 1 ⁰C increments for 5 s each using a CFX Connect Real-Time PCR Detection System (BioRad). SYBR fluorescence was detected after every temperature increase ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 40 cycles of 95 °C for 5 sec and 60 °C for 30 sec using the CFX 96 real-time systems (Biorad). The 2−ΔΔCt method was used to analyze the data (Schmittgen and Livak ...
-
bioRxiv - Cancer Biology 2022Quote: ... 95°C for 2 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min (BioRad). The following primers from Integrated DNA Technologies (IDT ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were heated from 10 °C to 95 °C (10 s at each 0.5 °C step) using a CFX Connect qPCR with CFX Manager software (Bio-Rad). Melting temperatures were calculated with DSFWorld27 (by model 2).
-
bioRxiv - Systems Biology 2023Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad). The results were normalized to GAPDH from the same well ...
-
bioRxiv - Systems Biology 2023Quote: ... reverse transcription for 20 mins at 46 °C and inactivation for 1 min at 95 °C) in a thermal cycler (C1000 Touch, Biorad). For gene expression assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by 15 minutes at 50°C and 5 minutes at 85°C in T100 Thermal Cycler (1861096, Bio-Rad). Real-time qPCR reactions were performed using SsoAdvanced Universal SYBR® Green Supermix (1725274 ...
-
bioRxiv - Microbiology 2023Quote: ... and 40 cycles of PCR (5 s at 95°C followed by 20 s at 60°C) in a CFX Opus 96 Real-Time PCR System (BioRad). Results were analyzed by the Comparative Ct Method (ΔΔCt Method ...
-
bioRxiv - Biochemistry 2024Quote: ... at a 20-90°C gradient (increment: 0.3 °C, hold for 5 s before read) on a Real-time PCR system (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... followed by 60 min at 37°C and a final 10 min at 21°C in a T100 Thermal Cycler (BioRad). All samples were pooled ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... 30 second at 72°C and a final extension of 7 minutes at 72 °C in a thermal cycler (T100TM Thermal Cycler, Bio-Rad). Five μl of PCR product was visualized on a non-denaturing 1% agarose gel with a 100bp ladder ...
-
bioRxiv - Developmental Biology 2020Quote: ... 50 seconds at 72°C and a final extension of 5 minutes at 72 °C in a thermal cycler (T100TM Thermal Cycler, Bio-Rad). In order to standardize the expression pattern of NvDsx ...
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were heated at a rate of 0.5 °C per minute from 25 °C to 95 °C and fluorescence signals were recorded with the CFX Connect Real-Time PCR Detection System (Bio-Rad). The melting temperatures were analyzed using the derivative plots of the melting curve.
-
bioRxiv - Microbiology 2020Quote: ... was added to each well and samples were heated from 25 to 95 °C in 1 °C steps of 1 min each in a CFX96 Touch™ Real-Time PCR Detection System (BioRad). Excitation/emission filters of 492 and 516 nm were used to monitor the fluorescence increase resulting from binding of the Sypro Orange to exposed hydrophobic regions of the unfolding MsSepFcore ...
-
bioRxiv - Plant Biology 2021Quote: ... All qPCR reactions were run for 94°C for 2 min followed by 94°C for 15 s and 60°C for 1 min in a BioRad CFX384 Real Time System (Biorad, USA) qPCR machine ...
-
bioRxiv - Microbiology 2022Quote: ... SYPRO orange fluorescence data in relative fluorescence unit (RFU) was collected from 10 °C to 95 °C using CFX Connect Real-Time PCR Detection System (Bio-Rad). The temperature corresponding to the lowest point of the first derivative −d(RFU)/dT was determined to be the Tm.
-
bioRxiv - Cancer Biology 2022Quote: ... then 40 cycles of 15 seconds at 95°C and 60 seconds at 60°C using CFX96 Touch Real-Time PCR Detection System (Bio-rad). A standard curve was derived from the serial dilutions of DNA template following concentrations ...
-
bioRxiv - Biochemistry 2022Quote: ... SYPRO orange fluorescence data in relative fluorescence unit (RFU) was collected from 10 °C to 95 °C using CFX Connect Real-Time PCR Detection System (Bio-Rad). The temperature corresponding to the lowest point of the first derivative ...
-
bioRxiv - Microbiology 2021Quote: ... Binding reactions were incubated for 40 minutes at 37 °C then run on a precast 5% TBE acrylamide gel at 4 °C for 45 minutes at 100 V (Bio-Rad). After transfer to Biodyne B Modified Nylon Membrane (ThermoFisher) ...
-
bioRxiv - Bioengineering 2020Quote: ... followed by 40 cycles of 95°C for 5 s and 60°C for 30 s (Bio-Rad CFX manager 3.1). Quantification of mRNA levels of different genes was performed using the 2−ΔΔct method ...
-
bioRxiv - Microbiology 2021Quote: ... 60°C for 30 sec and 72°C for 30 sec on a Bio-Rad CFX96 qPCR cycler (Bio-Rad, Germany).
-
bioRxiv - Microbiology 2022Quote: ... and 40 cycles of PCR (5 s at 95°C followed by 20 s at 60°C) in a CFX Opus 96 Real-Time PCR System (Bio-Rad). Results were analyzed by the Comparative CT Method (ΔΔCt Method) ...
-
bioRxiv - Biochemistry 2022Quote: ... was measured over temperatures ranging from 10 °C to 95 °C using a CFX Connect Real-Time PCR Detection System (Bio-Rad). Melting temperature (Tm ...
-
bioRxiv - Neuroscience 2022Quote: ... at either 95°C for 5 minutes or at 70°C for 10 minutes and resolved in a 4-15% Precast Gels (Bio-Rad, 12-well ...
-
bioRxiv - Cancer Biology 2024Quote: ... 40 cycles of 95 °C for 5 s and 60 °C for 10 s using a CFX Connect Real-Time PCR System (Bio-Rad). The relative expression levels of mRNA were calculated using the 2−ΔΔCt method.
-
bioRxiv - Microbiology 2023Quote: ... was added to each well and the mixture was heated from 25 to 95°C in 1°C steps of 1 min each in a CFX96 Touch™ Real-Time PCR Detection System (BioRad). Excitation and emission filters of 492 and 516 nm respectively ...