Labshake search
Citations for Bio-Rad :
51 - 100 of 1482 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were denatured at 95 °C for 3 minutes prior to loading onto a 16.5% Mini-PROTEAN® Tris-Tricine Gel (Biorad Cat. No. 4563066). Gels were transferred to a nitrocellulose membrane (Millipore Sigma Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Myc-5-HT1A-R and eGFP were performed at 13–14 DIV using Transfectin (Bio-Rad), according to the instructions of the manufacturer (DNA/lipofectant ratio of 1:3) ...
-
bioRxiv - Bioengineering 2021Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 s at 180°C by using a plate sealer (BioRad PX-1; CA, USA) and maintained at 4°C during the LC-MS measurement ...
-
bioRxiv - Systems Biology 2021Quote: ... incubated 5 min at 65 °C and separated by 12% SDS-PAGE (65) in the Mini Protean 3 Apparatus (BioRad Laboratories, Hercules, CA, USA). The final concentration of proteins was 10 μg per lane ...
-
bioRxiv - Genetics 2022Quote: ... the membranes were washed 3 times for 10 min each with TBST buffer at 24 °C and visualized using enhanced chemiluminescence reagents (Bio-Rad Laboratories, CA, USA). The images were captured using Image Quant LAS 4000 (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2021Quote: ... and O’nyong yong virus (ONNV) were subjected to a thermal gradient treatment from 30 to 60 °C for 3 h with a thermocycler (Bio-Rad T100 Thermal Cycler), after which samples were immediately titrated on Vero cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 seconds at 180°C by using a plate sealer (BioRad PX-1; CA, USA) and maintained at 10°C during the LC-MS measurements ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate was sealed with a pierceable seal (4titude; Wotton, UK) for 3 s at 180 °C using a plate sealer (PX-1; Bio-Rad, Hercules, CA, USA) and maintained at 10 °C during the LC-MS measurements ...
-
bioRxiv - Microbiology 2022Quote: ... 59.2°C and 60°C using PCR thermal cycler (Biorad) for 30 min before HA assay.
-
bioRxiv - Microbiology 2022Quote: ... 59.2°C and 60°C using PCR thermal cycler (Biorad) for 30 min or left at 4°C as control before HA assay.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein samples were heated for 3 min at 95°C and loaded on a 12-well Mini-PROTEAN TGX Stain-Free Gel (Bio-Rad Laboratories, Inc, Hercules, CA, USA). SDS-PAGE followed by densiometric analysis using the software ImageJ32.
-
bioRxiv - Biochemistry 2021Quote: ... Mixtures were heated to 90°C for 10 min and slowly cooled to 40°C (0.1°C / second) using a Dyad PCR machine (Bio-Rad).
-
bioRxiv - Biochemistry 2022Quote: ... Samples were heated from 10 °C to 95 °C (10 s at each 0.5 °C step) using a CFX Connect qPCR (Bio-Rad). Melting temperatures were calculated with DSFWorld61 using model 1 in the “by sigmoid fitting” option ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with a three-step protocol (95°C 15 sec, 60°C 30 sec, 68°C 60 sec) and iTaq Universal SYBR Green Supermix (Bio-Rad). Primer sequences are provided in Table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pAc5.1-dTRPA1-A and pAc5.1-EGFP were transiently co-transfected into control or dAGPS stable cells using TransFectin Lipid Reagent (BioRad). After a 24 h incubation ...
-
bioRxiv - Physiology 2020Quote: ... rabbit polyclonal anti-Cytochrome C (Cyt C) (AHP2302, Bio-Rad Laboratories, 1:500), mouse monoclonal anti-MMP2 (sc-13595 ...
-
bioRxiv - Bioengineering 2020Quote: ... and annealed from 90°C to 20°C at 1 °C min-1 in a T100™ Thermal Cycler (Bio-Rad, USA). Following construction ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Neuroscience 2020Quote: ... the entire background-adjusted lane area above the Fluc-EGFP monomer band was quantified using Image Lab™ Software (Biorad).
-
bioRxiv - Cancer Biology 2024Quote: ... the plate was held at 4 °C until the lid temperature cooled to 37 ºC and could be stored at 2 °C to 8 °C overnight before analysis on the QX600 Droplet Reader (Bio-Rad Laboratories, California, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... denaturation at 95°C by 0.5°C in a Real-Time PCR apparatus (BioRad, USA). The genes of interest in this study are listed in supplementary Table 3 ...
-
bioRxiv - Biophysics 2024Quote: ... the solution was heated and slowly cooled from 80°C to 4°C (ramp rate of -1°C per 5 s) in a standard thermocycler (Bio-Rad CFX96 Real-Time System) prior to each experiment.
-
bioRxiv - Microbiology 2023Quote: ... with 10 μg of plasmid DNA expressing LpAsp-GFP or LpCht-GFP as well as pTrex-n-eGFP using a Gene Pulser X cell electroporator (Bio-Rad) and cuvette (2 mm gap) ...
-
bioRxiv - Molecular Biology 2023Quote: ... When 70–90% confluent HEK293 were transiently transfected with 1.9 μg of plasmid carrying TMEM16A and 0.1 μg plasmid encoding eGFP using Lipofectamine (Bio-Rad, Copenhagen, Denmark). Two-three days after transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... from 20°C to 95 °C in C1000 Thermal Cycler CFX96 Real-time System (Bio-Rad). Tm was determined as a local minimum of the first derivative of the raw fluorescence as function of temperature with software Bio-Rad CFX Manager 3.1.
-
bioRxiv - Physiology 2023Quote: ... 120 min at 37 °C and 5 min at 85 °C in a Thermocycler (T100, BioRad). For real-time amplification ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Bioengineering 2021Quote: eGFP fluorescence was analysed by flow cytometry measurements for bioreactor and shake flask cultivation applying S3e™ Cell Sorter (Bio-Rad, Germany) applying a 488 nm laser in combination with a 525/30 nm filter ...
-
bioRxiv - Plant Biology 2024Quote: ... The plasmid DNA (5 µg) of eGFP and DsRed2 fusion constructs were coated on tungsten particles (1.1 µm in diameter; Bio-Rad, 165-2267) in a suspension containing 16 mM spermidine and 0.1 M CaCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 62 cycles (10′′ 65 °C + 0.5 °C) in the SYBR-Green-Cycler IQ5 detection protocol (Biorad CFX384), performed in 384-well plates (Merck) ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4 minutes at 72°C and then final extension at 72°C for 10minutes (MyCycler, Bio-rad). After the reaction ...
-
bioRxiv - Immunology 2022Quote: ... 42 °C for 50 min and 85 °C for 5 min in a thermal cycler (Bio-Rad, USA). Synthesized cDNA was kept at −80 °C till further use ...
-
bioRxiv - Cell Biology 2023Quote: ... Precision Plus Protein Western C ladder (BioRad) and Precision protein Streptactin-HRP conjugate (BioRad ...
-
bioRxiv - Biochemistry 2020Quote: ... The temperature was varied 25 - 95 °C in 0.5 °C increments by using an iCycle IQ5 real-time PCR system (BioRad). Relative fluorescence was measured using excitation and emission wavelengths of 580 nm and 623 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... MDH2 aliquots were heated to 42 °C for 10 min then returned to 37 °C in a thermocycler (BioRad), while native samples were maintained at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The fluorescence was measured at 512 nm along a temperature gradient from 20 to 100 °C (0.5°C increase every 10 s) in the CFX ConnectTM real-time thermocycler (BioRad) with the Cfx MaestroTM software ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Subsequently the samples were heated to 75 ◦C for 1 min and then cooled down to 25 ◦C with a temperature gradient of −0.5 ◦C per min in a thermocycler (BioRad). For bundling ...
-
bioRxiv - Plant Biology 2024Quote: ... 10 s at 60 °C and 30s at 72 °C with a CFX Connect Real-Time system (Bio-rad). ΔΔCt was used to analyze the gene expression data.
-
bioRxiv - Molecular Biology 2024Quote: ... Melt curve between 65°C and 70°C was analysed using Bio-Rad Precision melt software (Bio-Rad, CA) to identify sex genotypes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...