Labshake search
Citations for Bio-Rad :
101 - 150 of 397 citations for Flumoxef sodium impurity P since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Biochemistry 2020Quote: ... The complex was exchanged into EM buffer using a Bio-Spin P-30 column (Bio-Rad). The concentration of complex was estimated from absorbance at 280 nm and 1 equivalent of dsDNA (61 base pairs ...
-
bioRxiv - Microbiology 2020Quote: ... in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad). The radiolabeled probe was heated to 100°C for 2 minutes and resuspended in 10 mL of ULTRAhyb Oligo hybridization buffer (Ambion) ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Immunology 2020Quote: ... the reaction mixture was passed through 2 Bio-Gel P-2 mini columns (1504114, Bio-rad) by centrifugation (3000 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... The final reaction mix was desalted using Micro Bio-Spin P-30 columns (Bio-Rad, 7326250), then denatured by incubating with 0.5X volume of gel-loading buffer (8 M urea ...
-
bioRxiv - Cell Biology 2024Quote: ... ATG16L1 P-S278 antibody was diluted at 1:4000 in EveryBlot blocking buffer (Bio-Rad, 12010020) and incubated overnight ...
-
bioRxiv - Microbiology 2024Quote: ... Hydrolysis products were separated using a self-packed column of P-4 fine resin (Bio-Rad) and identified using the neutral sugar assay ...
-
bioRxiv - Neuroscience 2020Quote: ... These proteins were then subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (Bio-Rad) and transferred onto PVDF membranes (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: Sodium-Dodecyl-Sulphate (SDS) Polyacrylamide Gel Electrophoresis was done in precast gels (Bio-Rad TGX Mini-Protean 4-15% gels with Dual Colour Standard ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Proteins (10-50 µg) were loaded onto 10% sodium dodecyl sulfate polyacrylamide gel (BioRad), separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Immunology 2024Quote: ... Whole-cell lysates (RIPA buffer) separated on 10% sodium dodecyl sulfate-polyacrylamide (Bio-Rad) gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Cell Biology 2022Quote: ... Then the protein-dye conjugate was flowed through a gel separation column (Bio-rad Biogel P-30) to purify the labeled protein ...
-
bioRxiv - Microbiology 2021Quote: ... an assay detecting the human ribonuclease P/MRP subunit p30 RPP30 gene (Bio-Rad Assay ID dHsaCP2500350) was used as reference (probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 6.8 and the RNA was cleaned up with Micro Bio-Spin P-30 gel columns (Biorad). RNA was biotin-labelled with 50 μl 0.1 mg/ml MTSEA biotin-XX linker (Biotium ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The labeled ASC-ST-DLL4 was then purified by desalting on a P-30 column (Bio-Rad). The final molar ratio of JF646 to ASC-ST-DLL4 was 5:1.
-
bioRxiv - Plant Biology 2023Quote: ... the treated protein was cleaned up using a Micro Bio-SpinTM P-6 Gel Column (BIO-RAD), and then they were further subjected to 5 mM sodium (meta ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were further purified by performing a buffer exchange using P-30 columns (Bio-Rad, Hercules, CA) and another ethanol precipitation ...
-
bioRxiv - Biochemistry 2024Quote: ... DTT was removed using “Micro Bio-Spin® Columns with Bio-Gel® P-30” (Bio-Rad).
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were then desalted on Bio-Gel® P-6DG gel (BIO-RAD, Hercules, CA, USA) equilibrated with 20 mM sodium phosphate buffer pH 7.4 containing 0.15 M NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... The unconjugated dye was removed by size exclusion using Bio-Spin P-30 gel columns (Bio-rad) equilibrated in PBS pH 7.4 ...
-
bioRxiv - Cell Biology 2024Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer supplemented with 10% glycerol ...
-
bioRxiv - Cell Biology 2024Quote: ... and the eluate was desalted using a Bio-Rad Bio-Gel P-6 Desalting Cartridge (Bio-Rad). Subsequently ...
-
bioRxiv - Plant Biology 2021Quote: ... dissolved in a sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (Bio-Rad) and separated on 15 % SDS-PAGE gels following the Laemmli method (Laemmli ...
-
bioRxiv - Neuroscience 2022Quote: ... A 12% sodium dodecyl sulfate-polyacrylamide gel was prepared according to manufacturer’s protocol (BIO-RAD). For the analysis 32 μl of the production supernatant was mixed with 8 μl 5xLaemmli buffer containing ß-Mercaptoethanol and incubated for 10 min at 95°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... miR-146a-loaded MLNPs were lysed with 0.5% sodium dodecyl sulfate (SDS) (BioRad, Hercules, CA), and loaded onto 2% agarose (Fisher BioReagents ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated in 4–15% sodium dodecyl sulfate/polyacrylamide gel electrophoresis gel (Bio-Rad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Bioengineering 2024Quote: ... in 0.1M sodium phosphate buffer pH 7.3 previously treated with Chelex 100 chelating resin (BioRad), and reacted at 4°C for 18 hr ...
-
bioRxiv - Genomics 2020Quote: ... Labeled probes were then purified using Micro Bio-Spin® Columns with Bio-Gel® P-30 (BioRad).
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was purified by loading quenched samples onto Micro Bio-spin Columns with Bio-Gel P-6 (BioRad), followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2020Quote: Protein extracts were fractionated by 10% SDS-PAGE and electroblotted onto Immobilion-P polyvinyl difluoride membranes (Bio-rad) in CAPS-based transfer buffer (10 mM CAPS pH 11 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The probes were cleaned using Micro Bio-SpinTM P-30 Gel Columns with RNase-free Tris Buffer (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... proteins were transferred onto a blotting membrane (Immobilon-P) with a wet mini trans-blot cell (Bio-Rad). Blots were blocked for an hour in Tris-buffered saline with Tween 20 and 5% skim milk ...
-
bioRxiv - Biochemistry 2024Quote: ... Excess auranofin was removed using “Micro Bio-Spin® Columns with Bio-Gel® P-30” (Bio-Rad) pre-equilibrated with PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2024Quote: ... Generated probes were purified using Micro Bio-SpinTM P-30 Gel Columns with RNase-free Tris Buffer (BioRad) according to the manufacturer’s protocol and stored at −80°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... The reactions were stopped by removing unreacted substrate using Bio-Spin P-30 Tris desalting columns (Bio-Rad). The RNA concentration of each sample was quantified by Qubit® 3.0 Fluorometer (Thermo Fisher Scientific) ...
-
The triad interaction of ULK1, ATG13, and FIP200 is required for ULK complex formation and autophagybioRxiv - Cell Biology 2024Quote: ... and 150 mM NaCl utilizing a Bio-Scale Mini Bio-Gel P-6 desalting column (Bio-Rad Laboratories). Subsequently ...
-
bioRxiv - Biochemistry 2024Quote: ... Excess dye was removed by passing the reaction mixture through a P-30 Bio Spin column (Bio-Rad). The labeled protein ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated on a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis precast gel (Bio-Rad), and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Physiology 2022Quote: ... and separated in an 4%–20% sodium dodecylsulfate (SDS) polyacrylamide gel system (Biorad, Hercules, CA, USA). After transfer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Thirty micrograms of protein were loaded onto sodium dodecyl sulfate−polyacrylamide gel for electrophoresis (Bio-Rad) and transferred onto PVDF membranes (Millipore ...
-
bioRxiv - Genetics 2021Quote: ... Total proteins were separated with 7.5% Mini-PROTEAN TGX sodium dodecyl sulfate polyacrylamide gel (Bio-Rad) with 20 µg of protein per lane ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Bio-Rad Laboratories, CA, USA) and transferred onto polyvinylidene difluoride membranes (Invitrogen ...
-
bioRxiv - Biophysics 2022Quote: ... washes and elutes were examined using SDS-PAGE (sodium dodecyl sulfate– polyacrylamide gel electrophoresis) (Gel: BioRad miniPROTEAN TGX AnyKD - 4569036 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 µl of lysate or supernatant were loaded on sodium dodecyl sulfate-polyacrylamide gels (BioRad, 4561093) for gel electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein lysates were separated using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE, Bio-Rad) and then transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... The pellets were lysed in a 2% sodium dodecyl sulfate (SDS) (BR1610302; Bio-Rad, CA, USA) solution containing a protease inhibitor cocktail (4693116001 ...