Labshake search
Citations for Bio-Rad :
101 - 150 of 1904 citations for 7 CHLOROTHIENO 3 2 B PYRIDINE 6 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then covered by Microseal ‘B’ seal (Bio-Rad, USA). The qRT-PCR was run in the BIO-RAD CFX Connect-system (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... or Magic Red Cathepsin B substrate (ref. ICT937, Bio-Rad). These dye molecules have an emission spectrum within the similar range than the one of FND ...
-
bioRxiv - Biochemistry 2021Quote: ... sealed with optically clear Microseal ‘B’ Adhesive Sealer (Bio-Rad). Each sample was measured in technical duplicate and in a final volume of 20 μl ...
-
bioRxiv - Systems Biology 2021Quote: ... Primer plates were sealed with Microplate B seals (Bio-Rad) and PCR was performed using a Bio-Rad C1000 Thermal Cycler with the following program ...
-
bioRxiv - Systems Biology 2020Quote: ... Primer plates were sealed with Microplate B seals (Bio-Rad) and PCR was performed using a Bio-Rad C1000 Thermal Cycler with the following program ...
-
bioRxiv - Genetics 2019Quote: ... sealed with microSeal ‘B’ plate sealing film (Bio-Rad, msb1001), and homogenized in a microplate-horn sonicator (Qsonica ...
-
bioRxiv - Cell Biology 2020Quote: The Magic Red™ Cathepsin B kit (Bio-Rad, ICT937) was used to analyze the protease activity of Cathepsin B in lysosomes as a proxy to lysosome function ...
-
bioRxiv - Immunology 2022Quote: ... sealed with Microseal ‘B’ PCR Plate Sealing Film (Bio-Rad) on the QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... sealed with Microseal® B Adhesive Sealers (Biorad MSB- 1001). Two independent oligonucleotide sets each were used for CDR1 ...
-
bioRxiv - Systems Biology 2023Quote: ... Primer plates were sealed with Microplate B seals (Bio-Rad) and PCR was performed using a Bio-Rad C1000 Thermal Cycler with the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... for 7 min in a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with 3% BSA in TBST and incubated with mouse anti-His monoclonal antibody overnight in a cold room ...
-
bioRxiv - Cell Biology 2019Quote: ... and droplet generation oil (Bio-rad, 1864006; 7 ml per run), were connected to a microfluidics device (FlowJEM ...
-
bioRxiv - Immunology 2021Quote: ... and mouse anti-pig CD203a-FITC (clone PM18-7; Bio-Rad). Granulocytes were defined as 2B2+CD203a- ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a Minisize PVDF 7 membrane (BioRad) using a semi-dry transfer (TurboBlot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PV1s (7 μg) and molecular weight marker (Dual Color, Bio-Rad) were transferred from SDS-PAGE 16% gels onto nitrocellulose membranes (Amersham ...
-
bioRxiv - Cancer Biology 2019Quote: ... Immunohistochemistry for Sdc1 (1:50 dilution of B-A38, Bio-Rad) was performed by the VCU Cancer Mouse Models Core Laboratory with the Leica Bond RX auto-stainer using heat-induced epitope retrieval buffer 1 (Leica ...
-
bioRxiv - Microbiology 2020Quote: ... influenza type b serogroup-specific antisera (Bio-Rad., Pastorex™ Meningitis). Streptococcus pneumonia (S ...
-
bioRxiv - Molecular Biology 2019Quote: ... The measurement was performed in sealed (Microseal B Adhesive Sealer, BioRad) black 96-well clear bottom plates (flat bottom ...
-
bioRxiv - Bioengineering 2020Quote: ... After sealing with a Microseal® B Adhesive sealer (Bio-Rad), the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Plates were sealed using Microseal B adhesive sealers (BioRad MSB-1001). The following day ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Genomics 2020Quote: ... and reactions were covered with Microseal ‘B’ PCR Plate Seals (Biorad, CA) to avoid evaporation ...
-
bioRxiv - Genetics 2020Quote: ... Plates were sealed using a microseal ‘B’ Adhesive Seal (Bio-Rad MSB1001) and the reaction progress was recorded during 40 cycles using a C1000Touch plate reader (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... The reaction was sealed with Microseal ‘B’ PCR Plate Seals (Biorad, CA) and incubated for at least 6h ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plate was sealed with a microseal B adhesive (Bio-Rad MSB1001) and incubated in a plate reader with continuous shaking for 18 hr at 37 °C and absorbance measurements at 600 nm every 15 min.
-
bioRxiv - Immunology 2023Quote: Magic Red® Cathepsin (B, L or K) assay kit (Bio-Rad) was used to determine the activity of cathepsin in cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... sealed with optical quality sealing tape (Microseal® ‘B’ seal from BIO-RAD). Data were analysed using the software Origin 8.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH and b-globin RNA was then quantified using digital droplet PCR (Biorad). Values in each eluate were normalized to the corresponding values in the input and the enrichment of GFP-RAB13 RNA over GAPDH was assessed.
-
bioRxiv - Microbiology 2023Quote: ... The PCR plate was sealed with a Microseal ‘B’ seal (Bio-Rad, MSB1001) and spun to remove air bubbles ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Optical Microseal ‘B’ PCR Plate Sealing Film (Bio-Rad, cat. no: MSB1001). PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... Densitometry analysis was carried out using Image Lab (v6.1.0 build 7, Bio-Rad, SG). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...