Labshake search
Citations for Bio-Rad :
401 - 450 of 1904 citations for 7 CHLOROTHIENO 3 2 B PYRIDINE 6 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and 2-Mercaptoethanol (BioRad, cat # 1610710) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Biobeads SM-2 resin (Bio-Rad) was added at a ratio of 1:5 (w/v) ...
-
bioRxiv - Immunology 2022Quote: ... and SM-2 beads (Bio-Rad) as previously described (9) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Systems Biology 2022Quote: ... 2 µL propidium iodide (BioRad, 1351101) was added to the single-cell suspension and sorting was performed on the PI-negative live cell population using fluorescent-activated cell sorting (FACS) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 2-mercaptoethanol (BIO-RAD, 1610710) was added to the samples which were heated (95°C ...
-
bioRxiv - Biophysics 2023Quote: ... and bis-acrylamide (2% solution, BioRad) were polymerized by addition of 0.1%(v/v ...
-
bioRxiv - Immunology 2023Quote: ... Kallestad HEp-2 slides (BIO-RAD) were stained overnight with 1µL of serum from either Lyn-/-IgD+/- or wildtype mice ...
-
bioRxiv - Cell Biology 2023Quote: ... 66 µl 2% bisacrylamide (Bio-Rad), 334 µl water for a final concentration of 12.5% acrylamide and 3.75% bisacrylamide in water ...
-
bioRxiv - Bioengineering 2024Quote: ... 2% Bis-Acrylamide solution (BIORAD, #1610142), and distilled water was blended and adjusted to manufacture PA gels with varying rigidity ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were activated with methanol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2% Bis-Acrylamide (Bio-Rad) with milliQ water as described elsewhere 38 ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and loaded on a 3-8% tris-acetate gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... After washing the plate 3× (MAG3× setting on BioRad wash station) with wash buffer (PBS with 0.05% Tween20) ...
-
bioRxiv - Cell Biology 2019Quote: ... and loaded onto 3-8% Tris-acetate gels (Bio-rad, #3450131). Purified bovine 19S (UBPbio ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 3:1 with 4x Laemmli buffer (Biorad, cat. no. 1610747) containing β-mercaptoethanol and heated at 95°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Protein concentration was quantified using a BCA assay and loaded at 25- 50ug in 1x Lamelli Buffer with B-mercaptoethanol onto a 4-15% TGX protean gel (Bio-Rad). In some experiments to achieve greater separation to detect the N-truncation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SYBR Green qPCR was performed using a ViiA7 (A&B Biosystems, Waltham, MA) with iTaq Universal SYBR Green One Step Kit (BioRad, #1725151) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL re-suspended Fraction B pellets were run 1 cm onto an Any kD Mini-Protean TGX gel (Bio-Rad) followed by Coomassie Blue staining ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins incubated with Mal-B were electrotransferred to PVDF membranes using a Trans-blot SD semi-dry transfer cell (Bio-Rad). Biotin incorporation was assessed by incubating blots with HRP-streptavidin (1:1000 v/v ...
-
bioRxiv - Biophysics 2020Quote: ... 50 µl of a 10− 6 M biotinylated and 10−7 M dye-coupled oligonucleotide solution were co-incubated to anneal the oligonucleotides at 80 °C using a Thermocycler (BioRad, C1000 ThermoCycler), followed by sample cooling to 4 °C with -1 °C/min ...
-
bioRxiv - Immunology 2021Quote: ... The cells were centrifuged at 300G for 7 minutes at 4°C and the cell pellet was resuspended then counted with the BioRad cell counter (Bio-Rad, TC20).
-
bioRxiv - Neuroscience 2021Quote: ... Lcn2 and C3 were quantified by quantitative real-time PCR (qRT-PCR) using the QuantStudio 7 Pro System thermo-cycler (ThermoFischer Scientific) and SYBR Green Master Mix (Bio-Rad Laboratories). Data are shown as fold change relative to control samples using the ΔΔCq method with Rpl4 as an internal control gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed with the Applied Biosystems ViiA 7 system using iTaq Universal SYBR Green Supermix (Bio-rad #1725121). Human actin was used as a house keeping control ...
-
bioRxiv - Cell Biology 2022Quote: ... To verify the generation of single chain antibodies we prepared samples of whole and reduced antibodies with NuPAGE LDS Sample Buffer (4x) and run them in NuPAGE™ 7% Tris-Acetate Protein Gels (Bio-Rad) in denaturing ...
-
bioRxiv - Genomics 2019Quote: ... Resulting single-cell GEMs were collected at the completion of the run (~7 min) and linear amplification was performed in a C1000 Touch Thermal cycler with 96-Deep Well Reaction Module (Bio-Rad; 1851197): 72°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and image captured by continuous exposure for 7 minutes with a Bio-Rad ChemiDoc MP Imaging System (12003154, Bio-Rad, CA, USA). The protein expression was quantified by determining individual band density using ImageJ (FIJI ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments was separated on 20% denaturing acrylamide gel (5% crosslinker, 7 M urea, 1X TBE buffer) using Criterion™ cell apparatus (Bio-Rad) at 300 V for 40 to 60 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.