Labshake search
Citations for Bio-Rad :
451 - 500 of 2025 citations for 7 CHLOROTHIENO 3 2 B PYRIDINE 6 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL re-suspended Fraction B pellets were run 1 cm onto an Any kD Mini-Protean TGX gel (Bio-Rad) followed by Coomassie Blue staining ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins incubated with Mal-B were electrotransferred to PVDF membranes using a Trans-blot SD semi-dry transfer cell (Bio-Rad). Biotin incorporation was assessed by incubating blots with HRP-streptavidin (1:1000 v/v ...
-
bioRxiv - Biophysics 2020Quote: ... 50 µl of a 10− 6 M biotinylated and 10−7 M dye-coupled oligonucleotide solution were co-incubated to anneal the oligonucleotides at 80 °C using a Thermocycler (BioRad, C1000 ThermoCycler), followed by sample cooling to 4 °C with -1 °C/min ...
-
bioRxiv - Immunology 2021Quote: ... The cells were centrifuged at 300G for 7 minutes at 4°C and the cell pellet was resuspended then counted with the BioRad cell counter (Bio-Rad, TC20).
-
bioRxiv - Neuroscience 2021Quote: ... Lcn2 and C3 were quantified by quantitative real-time PCR (qRT-PCR) using the QuantStudio 7 Pro System thermo-cycler (ThermoFischer Scientific) and SYBR Green Master Mix (Bio-Rad Laboratories). Data are shown as fold change relative to control samples using the ΔΔCq method with Rpl4 as an internal control gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed with the Applied Biosystems ViiA 7 system using iTaq Universal SYBR Green Supermix (Bio-rad #1725121). Human actin was used as a house keeping control ...
-
bioRxiv - Cell Biology 2022Quote: ... To verify the generation of single chain antibodies we prepared samples of whole and reduced antibodies with NuPAGE LDS Sample Buffer (4x) and run them in NuPAGE™ 7% Tris-Acetate Protein Gels (Bio-Rad) in denaturing ...
-
bioRxiv - Genomics 2019Quote: ... Resulting single-cell GEMs were collected at the completion of the run (~7 min) and linear amplification was performed in a C1000 Touch Thermal cycler with 96-Deep Well Reaction Module (Bio-Rad; 1851197): 72°C for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments was separated on 20% denaturing acrylamide gel (5% crosslinker, 7 M urea, 1X TBE buffer) using Criterion™ cell apparatus (Bio-Rad) at 300 V for 40 to 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... and image captured by continuous exposure for 7 minutes with a Bio-Rad ChemiDoc MP Imaging System (12003154, Bio-Rad, CA, USA). The protein expression was quantified by determining individual band density using ImageJ (FIJI ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Neuroscience 2022Quote: ... macrophages were plated in a 24-well plate containing cover slips and incubated with the Magic Red cathepsin B substrate (1/250) (Bio-Rad, ICT938) for 2h ...
-
bioRxiv - Plant Biology 2019Quote: ... All reactions were run in hard-shell skirted 96-well plates with a white top and clear wells and sealed with Microseal ‘B’ adhesive film (BioRad, Hercules, CA). A CFX-96 detection system (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... Pla2g4a and Actin B cDNA levels in the hypothalamus were measured by ΔΔCt method using SYBR Green reagent (Bio-Rad, Hercules, CA). The information on primers is shown in table S1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... an affinity purified antibody generated against the SAX-7 cytoplasmic tail [gift of (Chen et al., 2001)] and 1:5000 goat anti-rabbit HRP secondary antibody (Bio-Rad #170-5046). For the loading control ...
-
bioRxiv - Immunology 2021Quote: ... Basically 300 ug of IVIG protein were subjected to isoelectric focusing (IPG) across pH gradients of 4-7 (Biorad, LifeSciences, Hercules, Ca, USA) or pH 6-11 (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to nitrocellulose membrane by semi-dry transfer using the Trans-Blot Turbo Transfer System (BioRad, 1.5 A for 7 min). Membranes were blocked in 5% milk in 1x PBS with 0.1% Tween 20 (PBST ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...