Labshake search
Citations for Bio-Rad :
51 - 100 of 792 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... The samples were purified for TEM imaging using the Freeze ’N Squeeze (Bio-Rad) gel extraction column and imaging samples were prepared as previously described.
-
bioRxiv - Plant Biology 2022Quote: ... Images were taken by ChemiDoc™ MP Imaging System (Bio-Rad, Catalog N° #12003154).
-
bioRxiv - Bioengineering 2023Quote: ... Purification of DNA origami structures was performed by gel extraction (Freeze ‘N Squeeze, BioRad) or PEG precipitation (46) ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were resolved in 4-15% pre-cast SDS-PAGE (Biorad cat n° 4561085) at 80V for two hours and transferred to PVDF membrane (Immobilon-P ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-rabbit IgG (H + L)-HRP (1:5000, BioRad,1706516) and anti-mouse IgG (H + L)-HRP (1:5000 ...
-
bioRxiv - Immunology 2021Quote: ... goat anti-rabbit IgG (H+L)-HRP conjugate (both Biorad) or Veriblot IP detection reagent (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... goat anti-mouse IgG (H+L)-HRP conjugate (Biorad 1706516), AffiniPure goat anti-rabbit IgG (H+L)-HRP conjugate (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2021Quote: ... and Goat Anti-Mouse IgG (H+L)∼HRP Conjugate (BioRad). Membranes were developed with SuperSignal® West Pico Luminol/Enhancer Solution (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... sheep anti-mouse IgG (H/L):HRP (AAC10P, Bio-Rad), anti-FLAG-Tag (M2 ...
-
bioRxiv - Immunology 2024Quote: ... We placed 2 g/L Chelex 100 resin (Bio-Rad) in the dialysis buffer to chelate divalent metal ions ...
-
bioRxiv - Cell Biology 2024Quote: ... Goat anti-rabbit IgG (H+L)-HRP conjugate (Bio-Rad) was applied in 1:10,000 dilution.
-
bioRxiv - Molecular Biology 2024Quote: ... goat anti-rabbit IgG (H+L)-HRP conjugate (BioRad; 1706515); and goat anti-mouse IgG (H+L)-HRP conjugate (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mononucleosomal DNA was purified using agarose gel electrophoresis and Freeze N’ Squeeze Columns (BioRad, #7326166). As a spike-in control ...
-
bioRxiv - Molecular Biology 2021Quote: Purified SARS-CoV-2 N protein was electrophoresed on 4-10% SDS-PAGE (Bio-Rad) and stained with Coomassie Brilliant Blue G-250 (CBBG-250) ...
-
bioRxiv - Microbiology 2020Quote: ... and transferred to Hybond N+ (Amersham Biosciences) membrane using a Trans-Blot Turbo system (Biorad). A denaturated DNA marker was used for size estimation.
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-mouse IgG (H + L)-HRP (1:5000, BioRad, 1706516).
-
bioRxiv - Cell Biology 2021Quote: ... Goat Anti Mouse IgG (H+L) HRP Conjugate (BioRad #170-6516) Blots (Immobilon-P transfer membrane ...
-
bioRxiv - Molecular Biology 2022Quote: ... and goat anti-mouse IgG (H+L)-HRP conjugate (Bio-rad). To detect FLAG-tagged protein bands ...
-
bioRxiv - Cancer Biology 2019Quote: ... Secondary antibodies with H+L HRP conjugates were purchased from BioRad (anti-rabbit ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-rabbit IgG (H+L)-HRP Conjugate (BioRad, 1:5000). Western blot samples were quantified using Image Lab 6.0.1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and goat anti-mouse IgG (H+L)-HRP conjugate (1706516, BioRad).
-
bioRxiv - Cancer Biology 2024Quote: ... Goat Anti-Rabbit IgG (H + L)-HRP Conjugate (Bio-Rad #1706515), Goat Anti-Guinea Pig IgG-HRP Conjugate (Sigma #A7289) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and goat anti-mouse IgG (H+L)-HRP conjugate (BioRad; 1706516). The hormones used were as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was quantified with the Bradford assay (cat n. 5000001, Bio-Rad Laboratories, Segrate, Italy). Proteins ...
-
bioRxiv - Cancer Biology 2020Quote: Fifteen micrograms pGuide-HCFC1-N and 10 μg pCRIS-mCherry-FLAG-dTAG-HCFC1 were electroporated (BioRad, Hercules ...
-
bioRxiv - Biophysics 2021Quote: ... The cut bands were transferred into Freeze ‘N Squeeze DNA Gel Extraction spin columns (Bio-Rad), crushed and extracted by centrifugation at 18,000g and 4°C for 10 minutes ...
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Bioengineering 2024Quote: ... Samples for Transmission electron microscopy (TEM) imaging were purified using the Freeze ’N Squeeze (Bio-Rad) gel extraction column as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was transferred to a Hybond N+ hybridization membrane (Amersham) using semi-dry electroblotting (Bio-Rad), cross-linked with UV irradiation (120 mJ/cm2 ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Genomics 2019Quote: ... and Goat Anti-Mouse IgG (H+L)-HRP Conjugate (1706516, Bio-Rad).
-
bioRxiv - Cancer Biology 2021Quote: ... or Goat Anti-Rabbit IgG (H+L)-HRP Conjugate (Bio-Rad, #1706515) secondary antibody ...
-
bioRxiv - Immunology 2022Quote: ... goat anti-mouse IgG (H+L)-HRP conjugate (Cat: #1721011, Bio-Rad) were used as secondary Abs ...