Labshake search
Citations for Bio-Rad :
1 - 50 of 792 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... N,N,N’,N’-Tetramethylethylenediamine (TEMED, 1610801, Bio-Rad), Ammonium persulfate (APS ...
-
bioRxiv - Molecular Biology 2024Quote: ... N,N,N′,N′-Tetramethylethylenediamine (TEMED) was sourced from Bio-Rad Laboratories.
-
bioRxiv - Neuroscience 2019Quote: ... N,N,N’,N’-Tetra-methyl ethylenediamine (TEMED, Bio-Rad, 161-0801), 10% ammonium persulfate (APS ...
-
bioRxiv - Microbiology 2024Quote: ... with transfer buffer (14.4 g/l glycine, 3 g/l Tris base and 15 % methanol) using mini-wet electroblotting system (Bio-Rad) at 55 V for 130 min ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of desired elasticities with a Poisson’s ratio of 0.5 ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of elasticity ...
-
bioRxiv - Cell Biology 2022Quote: ... tubulin tyrosine ligase (TTL).(18) Cells were collected using 1x Laemelii Buffer (Bio-Rad, #1610737) containing protease (Milipore-Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... n,n’-methylene-bis-acrylamide (BIORAD, 2% w/v stock solution), N-6-((acryloyl)amino)hexanoic acid crosslinker (N6 ...
-
bioRxiv - Bioengineering 2019Quote: Proliferation of MSCs was evaluated by determining the total cell count per well (n=3 wells/treatment/time-point) using a TC20 Automated Cell Counter (Bio-Rad).
-
bioRxiv - Bioengineering 2022Quote: ... 0.035-0.25% N,N-methylenebisacrylamide crosslinker (Bis, 2% w/v stock, 161040, BioRad), 0.06% SDS (5% w/v stock in DI water ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 35 µL N,N-methylenebisacrylamide crosslinker (2% w/v bis-acrylamide Solution, 1610142, Bio-Rad), 20 µL of 1:100 diluted fluorescent beads in DI water (FluoSpheres carboxylate-modified 0.2 µm ...
-
bioRxiv - Bioengineering 2023Quote: ... 35 µL N,N-methylenebisacrylamide crosslinker (2% w/v bis-acrylamide Solution, 1610142, Bio-Rad), 20 µL of 1:100 diluted fluorescent beads in DI water (FluoSpheres carboxylate-modified 0.2 µm ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 10 µL cDNA reaction was diluted to 200 µL and 3 µL was used with iTaq Universal SYBR Green Supermix (Bio-Rad) and 670 nM of primer pairs (Table S4 ...
-
bioRxiv - Biochemistry 2022Quote: ... stock solution of 40% neutral acrylamide and N,N’-methylenebisacrylamide in a 19:1 ratio (Bio-Rad) were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 hpf (n=40) or 48 hpf (n=25) embryos using the Aurum Total RNA Mini Kit (Bio-Rad). cDNA was then prepared with the RevertAid reverse transcriptase (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Biophysics 2023Quote: ... extracted agarose gel parts were divided by cutting several times and purified via Freeze N′ Squeeze columns (Freeze N′ Squeeze, 7326165, BioRad) according to the manufacturer’s instructions using a benchtop centrifuge (Biofuge fresco ...
-
bioRxiv - Biophysics 2019Quote: ... N-methylene-bis-acrylamide (Bio-Rad, Herculers, USA) are added ...
-
bioRxiv - Bioengineering 2019Quote: ... by means of O/N wet transfer (Bio-Rad) 4 °C at 30 V ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-mouse IgG (H+L) or goat anti-rabbit IgG (H+L) (Bio-Rad) were used as secondary antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... “L”represents the Western C (BioRad) protein ladder ...
-
bioRxiv - Microbiology 2022Quote: ... anti-Metapneumovirus N mouse monoclonal (1:25) (MCA4674, Bio-Rad), or anti-Influenza A nucleoprotein (NP ...
-
bioRxiv - Microbiology 2021Quote: ... intracellular cathepsin L activity was detected using the Magic Red Cathepsin L Assay Kit (Biorad cat# ICT941). Briefly ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... goat anti-mouse IgG(H+L)- or goat anti-rabbit IgG(H+L)-HRP conjugated (Bio-Rad, 1721019), followed by chemiluminescent detection with Clarity Western ECL Substrates (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... was purchased from G-Biosciences and Freeze ‘N Squeeze DNA gel extraction columns by Bio-rad, Inc ...
-
bioRxiv - Biophysics 2022Quote: ... which were subsequently used with Freeze ‘N Squeeze spin columns (BioRad).
-
bioRxiv - Cancer Biology 2024Quote: ... or SuperSignal West Femto (Thermo Fisher Scientific 34096)] on the ChemiDox XRSL+L(Bio-Rad).
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... final concentrations of 2X SsoADV Universal SYBR Green Supermix (BIORAD, n° 1725270) and 0.04μM of each primer ...
-
bioRxiv - Biophysics 2023Quote: ... and samples were extracted with Freeze N’ Squeeze spin columns (Bio-Rad) by centrifugation at 1,000 g for 60 minutes at 4 ºC ...
-
bioRxiv - Microbiology 2023Quote: ... Goat anti-mouse IgG (H/L): HRP (Biorad)
-
bioRxiv - Plant Biology 2023Quote: ... anti-rabbit IgG (H + L) secondary antibody and goat peroxidase-conjugated anti-mouse IgG (H + L) secondary antibody were purchased from Bio-Rad.
-
bioRxiv - Cell Biology 2020Quote: ... crushed and structures were purified with Freeze ‘N Squeeze spin columns (Bio-Rad) for 5 min at 1,000×g at 4 °C.
-
bioRxiv - Biophysics 2020Quote: ... crushed and spun through a Freeze N’ Squeeze column (BioRad Sciences, 732-6165) for 3 min at 13,000g at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... filtered through Freeze ‘N Squeeze DNA Gel Extraction Spin Columns (Bio-Rad; #7326165) and purified via ethanol precipitation ...
-
bioRxiv - Biophysics 2024Quote: ... Freeze ‘N Squeeze columns (catalog no. 732-6165) were obtained from Bio-Rad. Cy3b-maleimide (catalog no ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... 0.1 μg/mL anti-rhesus IgG (H+L) (BioRad), and irradiated 3T3msCD40L feeder cells ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 μg/ mL anti-rhesus IgG (H + L) (BioRad), and irradiated 3T3msCD40L feeder cells ...
-
bioRxiv - Biochemistry 2021Quote: ... A goat anti-rabbit IgG (H+L) and goat anti-mouse IgG (H+L) antibody with HRP conjugate (1706515 and 1706516, respectively, Bio-Rad, Hercules, CA) was used as a secondary detection antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... proteins were transferred onto a 0.45 μm nitrocellulose membrane (Bio-Rad, catalog n° 1620115) for 1 hour at RT at 100V ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples for AFM imaging were purified by using the Freeze ‘N Squeeze kit (BioRad) according to the manufacturer’s protocol.