Labshake search
Citations for Bio-Rad :
9651 - 9700 of 10000+ citations for Human Protein N terminal asparagine amidohydrolase NTAN1 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized with iScript cDNA Synthesis Kit (Bio-Rad). CDNA was diluted as appropriate for treatment ...
-
bioRxiv - Cell Biology 2023Quote: cDNA was synthesized using an iScript cDNA synthesis kit (BioRad). Real-time PCR was carried out on a ViiA 7 Real-Time PCR System (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthetized with iScript cDNA Synthesis Kit (Bio-Rad). For selected analyses ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with the iScript kit (Bio-Rad, #1708841) using 1mg of total RNA ...
-
bioRxiv - Immunology 2023Quote: cDNA was synthesized by iScript cDNA Synthesis Kit (Bio-Rad) using an extended 1h amplification ...
-
bioRxiv - Pathology 2024Quote: ... 5 μl of 2X iTaq Universal probe kit (Bio-Rad), 300 nM of forward and reverse primers and 200 nM of probe (Table S5 ...
-
bioRxiv - Microbiology 2024Quote: ... and qPCR performed using iTaq Universal Probes Kit (Bio-Rad) for SARS-CoV-2 primers52 ...
-
bioRxiv - Immunology 2024Quote: ... using SYBR Green PCR Master Mix Kit (Bio-Rad Laboratories) to examine lung mRNA expression of Cxcl1 ...
-
bioRxiv - Immunology 2024Quote: ... cDNA synthesis was performed using iScript cDNA synthesis kit (BioRad) according to the manufacturer guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using the iScript cDNA Synthesis Kit (BioRad) and qRT-PCR was performed using PCRBio SyGreen Blue Mix Lo-Rox (PCR Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... using iTaq universal Probes One-step RT-qPCR kit (BioRad) with N2 primers and probes (IDT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Germany and cDNA Reverse transcription kit was procured from Biorad. Lipofectmine reagent and Drabkins reagent ...
-
bioRxiv - Microbiology 2024Quote: ... and iTaq Universal SYBR Green One-Step kit (Bio-Rad). Primers for RT-qPCR are described in Table 3.
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was washed and developed using ECL kit (BioRad). Image analysis and quantification were performed using ImageLab software (BioRad).
-
bioRxiv - Plant Biology 2024Quote: ... we extracted RNA using Aurum Total RNA Mini Kit (BioRad), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blots were visualized using the Immuno-Star WesternC kit (BioRad) on a BioRad Chemidoc XRS+ system ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blots were visualized using the Immuno-Star WesternC kit (BioRad) on a BioRad Chemidoc XRS+ system ...
-
Adult choline supplementation in a Down syndrome model reduces co-morbidities and improves cognitionbioRxiv - Neuroscience 2024Quote: ... and cytokine levels via 23-plex kit (Bio-Rad; M60009RDPD). Plasma choline measures were measured in 20μL of plasma per animal ...
-
bioRxiv - Neuroscience 2024Quote: ... A Bradford kit was purchased from Bio-Rad (California, USA). For detailed information on the primary antibodies and reagents used in the present study ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was synthesized with iScript cDNA Synthesis Kit (BioRad). For qPCR ...
-
bioRxiv - Immunology 2024Quote: ... Reverse transcription was performed using iScriptTM cDNA Synthesis kits (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... complementary DNA (cDNA) prepared (iScriptTM cDNA Synthesis Kit (Bio-Rad)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and reverse transcribed with iScript cDNA Synthesis kit (Bio-Rad). Partial fragments of each genes were amplified with PCR by using gene-specific primers and cloned into pCR4-TOPO TA vector (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using the iScriptTM gDNA Clear cDNA Synthesis kit (Bio-Rad). Gene expression was measured using the SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad) ...
-
bioRxiv - Physiology 2024Quote: ... 1.25 µL ddPCR™ probe assay Kit (Bio-Rad Laboratories) which consist of forward (CGCAATCCTTTATTCTGTTCGA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplicons were purified using the oligonucleotide purification kit from BioRad.
-
bioRxiv - Molecular Biology 2024Quote: ... system using iTaq Universal SYBR Green One-Step Kit (Biorad). 150 ng of total RNA was loaded ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The qRT-PCR kits were purchased from BioRad (California, USA), and the ELISA kits were purchased from Peprotech ThermoFisher Scientific (Massachusetts ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA synthesis was conducted using the iScript kit (Bio-Rad). Gene expression was detected using cDNA as a template in a SYBR Green real-time PCR reaction on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... and cDNA was synthesized using cDNA reverse transcription kit (BioRad). The cDNA (10-20 ng ...
-
bioRxiv - Plant Biology 2024Quote: ... Signal was detected using a chemiluminescent substrate (Biorad, ECL kit).
-
bioRxiv - Bioengineering 2024Quote: ... The iScript™ gDNA Clear cDNA Synthesis kit (Bio-Rad) was used to generate cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: cDNA was synthesized using the iScript cDNA synthesis kit (Biorad) and quantitative PCR was performed on StepOnePlus Real-Time PCR Systems using Power SYBR® Green master mix and following primers ...
-
bioRxiv - Cell Biology 2024Quote: ... for chemiluminescent detection (Clarity Max ECL substrate kit, Bio-Rad). The raw images were exported and analysed in FIJI.
-
bioRxiv - Biophysics 2021Quote: ... We centrifuged the dialysis contents to remove any insoluble protein and then purified using cation exchange chromatography (BioRad UNOsphere Rapid S column) with an NaCl gradient ...
-
bioRxiv - Biophysics 2021Quote: The removal of DDM in the protein solutions was done by fixing the protein concentration at 1 mg/ml and using 30 mg of BioBeads SM2 (Bio-Rad, CA) per mg of protein ...
-
bioRxiv - Cell Biology 2020Quote: ... Equivalent amounts of total protein per lysate were loaded onto Criterion XT 4-12% Bis-Tris polyacrylamide gels (Bio-Rad, Hercules, CA), transferred onto PVDF membranes (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were boiled at 95°C for 5 minutes with Laemmli buffer and 20 μg of each was loaded into a 4-20% Mini-PROTEAN TGX Precast Protein Gel (BioRad, Hercules, CA). Gels were run at 100 V for 30-60 minutes and then transferred to PVDF membranes for 2 hours at 250 mV ...
-
bioRxiv - Plant Biology 2020Quote: ... the recombinant protein in the filtrate was further purified by size exclusion chromatography (NGCTM chromatography system with EnrichTM SEC 650 column, BioRad, Munich, Germany) in 50 mM NaH2PO4 /Na2HPO4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... by immunoprecipitation of endogenous or endogenously Flag-tagged Piwi (eF-Piwi): The anti-Piwi antibody and Surebeads Protein A Magnetic bead (Bio-Rad, 1614013) were used to immunoprecipitated endogenous Piwi-piRNAs from witld type OSC ...
-
bioRxiv - Microbiology 2022Quote: ... Brain homogenates were assayed at neat for all analytes and results were normalised to their total protein concentrations (Bio-Rad, Hercules, California).
-
bioRxiv - Neuroscience 2021Quote: ... 20 μg of total cell proteins were run in a 12% SDS-polyacrylamide gel and blotted to the PVDF membrane (Bio-Rad, USA). Membranes were incubated overnight at 4 °C with mature BDNF primary antibody (ThermoFisher OSB00017W ...
-
bioRxiv - Neuroscience 2021Quote: ... samples heat denatured and 20 µg of total protein was loaded per lane on 4-20% Tris-HCl polyacrylamide gels (BioRad, California, USA). After transfer to PVDF ...
-
bioRxiv - Molecular Biology 2020Quote: ... Biotinylated proteins were then eluted by boiling the magnetic beads in 30 μL 4 χ Laemmli sample buffer (Bio-Rad, Cat.# 1610747) supplemented with 20 mM DTT and 2 mM biotin.
-
bioRxiv - Molecular Biology 2020Quote: ... The membrane was incubated with primary antibody and horseradish peroxidase–conjugated secondary antibody, and then proteins were detected using the Pierce™ ECL Western Blotting Substrate (Thermo, #32209) by BIO-RAD ChemiDoc™ XRS+ system ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein was detected using an ECL system (Amersham Pharmacia, Piscataway, NJ, USA) and was analysed using Quantity One software (BIO-RAD, USA).
-
bioRxiv - Cell Biology 2022Quote: Protein homogenates (5 or 15 μg/lane) were size fractionated on 4–15% or 15% Criterion TGX gels (Biorad Laboratories, Oslo, Norway) and transferred to 0.45 μM PVDF-membranes (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1-20μg of tissue protein to be analyzed were combined with equal parts 2X Laemmli sample buffer (Bio-Rad, catalog 161-0737) containing 10% β-mercaptoethanol ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: Equal volumes of protein were loaded onto pre-cast BioRad Mini-Protean TGX precast Gel 4-20% (15-wells BioRad cat# 4568096). The gels were run according to the manufacturer’s guidelines (110Volts for 3 minutes ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... Proteins were separated on SDS-containing 8 to 12 % polyacrylamide gels and transferred to PVDF membranes (Bio-Rad Laboratories, Inc., Hercules, USA). After staining with primary and secondary antibodies ...