Labshake search
Citations for Bio-Rad :
6151 - 6200 of 9407 citations for Mouse Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... cDNA was reverse transcribed from RNA samples using the iScript cDNA Synthesis Kit (Biorad, Hercules, CA) according to the recommended reaction protocol on the ProFlex PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesised from 2 µg purified RNA using iScript™ cDNA Synthesis Kit (Bio-Rad) and quantified by qRT-PCR using iTaq™ Universal SYBR® Green Supermix ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration in lysates in urea buffer was quantified with a Bradford Protein assay kit (Biorad) and lysates in RIPA buffer with BCA protein assay kit (Pierce) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured using the DCTM Protein Assay Kit I from Bio-Rad (cat # 5000111) by following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 ng RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BIO-RAD) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and estimated for protein concentration using DC protein assay kit (Bio-Rad). For immunoblotting ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Protein concentration in the supernatant was measured using DC™ Protein assay kit (BIO-RAD, UK) according to manufacturer’s specifications using bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cDNA was generated from the RNA samples using an iScript kit (BioRad, Hercules, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... scATAC-Seq libraries were prepared using the SureCell ATAC-Seq Library Prep Kit (17004620, Bio-Rad) and SureCell ATAC-Seq Index Kit (12009360 ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein concentration was determined using the Bio-Rad DC™ Protein Assay Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and cDNA was prepared from samples with RIN > 6.0 using the iScript cDNA Synthesis Kit (BioRad). Gene expression was analyzed with SYBR-based reagents on a StepOne Plus Machine (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was reverse-transcribed to obtain cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708891), and qPCR was performed using PowerUp SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Pathology 2022Quote: ... we mixed the obtained cDNA with the SsoAdvancedTM Universal SYBR® Supermix kit (Bio-Rad, USA). After that ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was then prepared from 100 ng RNA using the iScript cDNA synthesis kit (Bio-Rad). qRT-PCR reactions were set up with 4 biological replicates ...
-
bioRxiv - Microbiology 2022Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad). Signals obtained by qPCR were normalized to those for 18S unless otherwise noted ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 250 ng of RNA using the iScript cDNA synthesis kit (Bio-Rad) (40 min ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized from total RNA (1.0 μg) using iScript cDNA Synthesis Kit (BioRad, Hercules, CA) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... and the Aurum™ Total RNA Mini Kit (catalogue #732-6820, Bio-Rad, Hercules, CA, U.S.A.). In addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 μg of RNA was used to synthesize cDNA using iScript cDNA Synthesis Kit (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was converted into cDNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative PCR was conducted to analyze the extracted DNA using QuantiFast SYBR Green PCR kit (Biorad) with universal 16S rRNA primers 8F ...
-
bioRxiv - Microbiology 2020Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad) on a QuantStudio3 real-time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein content was determined using a commercially kit (Protein Assay Dye Reagent; Bio-Rad, CA, USA) and bovine serum albumin as a standard (Bradford ...
-
bioRxiv - Microbiology 2020Quote: ... were used for detection using the enhanced chemiluminescence detection kits Clarity and Clarity Max ECL (Biorad).
-
bioRxiv - Neuroscience 2020Quote: ... and protein concentration of the supernatant was quantified using the DC protein quantification kit (Bio-Rad). Samples were stored at -80 °C until array analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse-transcribed to complementary DNA (cDNA) using a iScript cDNA synthesis kit (Bio-Rad, CA).19 Polymerase Chain Reaction was performed using qPCR master-mix (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... and then developed and visualized by reaction with chemiluminesence reagent (Clarity Western Blotting Substrates Kit, BioRad) on radiography film (Carestream Blue X-ray film) ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... cell extracts were quantified with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). After addition of 6X Laemmli buffer (375 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were transferred on to nitrocellulose membranes using the Biorad Trans-blot transfert system kit (Biorad) according to the supplier technical recommendation (7 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs were synthesized from 500 ng total RNA with the iScript cDNA Synthesis Kit (Bio-Rad). cDNAs were subjected to real-time PCR with the SYBR Green Fast Kit (Applied Biosystems) ...
-
bioRxiv - Biophysics 2021Quote: ... 500 ng of each sample were reverse transcribed with iScript gDNA clear cDNA Synthesis kit (BioRad) according to kit protocol and 10 ng of cDNA were analyzed for TMPRSS2 expression by real-time RT-PCR on a CFX Connect Real Time System using SsoAdvancedSybrGreen Supermix (BioRad) ...
-
bioRxiv - Developmental Biology 2021Quote: Reverse transcription was performed using the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Quantitative PCR was performed on the resulting cDNA using the iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was produced using the iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA). qPCR was performed using PrimePCR custom plates (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... The reverse transcription was performed using an iScript cDNA synthesis kit (Bio-Rad Laboratories, CA, USA) using the thermal profile ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis was performed with 1μg of total RNA using an iScript Reverse Transcription Kit (Biorad). qPCR reactions were made with the 2x SYBR Green Master Mix (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... Five hundred nanograms of RNA were reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 500–2000 ng of total RNA was reverse transcribed using iScript cDNA Synthesis kit (Bio-Rad). Quantitative PCR analysis was performed in duplicates using 1/100 of the reverse transcription reaction in a StepOnePlus (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... Extracted RNA was reverse transcribed using the iScript Advanced cDNA synthesis kit (Bio-Rad, Cat# 1725038). RT-qPCR was performed on the equivalent of 50 ng of cDNA with 500 nM of primer using SsoAdvanced Universal SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... and the RNA was converted into cDNA using the iScript™ cDNA synthesis kit (Bio-Rad). qRT-PCR was performed in a final volume of 10 μL using EvaGreen (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... and 200 ng of RNA were cDNA transcribed using the iScript™ cDNA Synthesis Kit (Biorad). Gene expression analysis was carried out using the PerfeCTa SYBR® Green SuperMix (Quantabio ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified RNA (500ng) was then used to make cDNA using iScriptTM cDNA synthesis kit (Bio-Rad). After cDNA synthesis each sample was resuspended to a total volume of 100µL using RNase-Free water ...
-
bioRxiv - Cell Biology 2022Quote: ... Isolated RNA was converted into cDNA using a iScript cDNA synthesis kit (Bio-Rad, cat:1708891). Gene expression analysis was performed using SYBR Green PCR master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized using total RNA and iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Reverse transcriptase-polymerase chain reaction (RT-PCR ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Reverse transcription was carried out using an iScript™ cDNA Synthesis kit (Bio-Rad, Hercules, CA). Real time PCR was carried out using an iTaq™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA samples (200 ng) were converted into cDNA by iScript cDNA synthesis kit (BIO-RAD, 1708891). cDNA products were cleaned up using the Nucleospin Gel and PCR clean-up kit (Machery Nagel ...
-
bioRxiv - Plant Biology 2019Quote: ... Reverse transcription was performed on 300 ng of total RNA using the iScript advanced kit (BioRad). PCR was performed using gene-specific primers as listed in the supplementary data Table S3 ...
-
bioRxiv - Physiology 2019Quote: ... ACPA was detected using the BioPlex® 2200 System anti-CCP reagent kit (Bio-Rad, US) and cutoff levels used were according to the manufacturer’s instructions ...