Labshake search
Citations for Bio-Rad :
5301 - 5350 of 9407 citations for Mouse Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Each analysis was performed in triplicate using iQ SYBR Green Supermix kit (Bio-Rad). Samples were standardized to a RP49 control ...
-
bioRxiv - Physiology 2019Quote: ... mRNA was reverse transcribed with iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) and quantitative RT-PCR was performed using Ssofast EvaGreen Supermix (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... then we performed reverse transcription using the iScriptTM cDNA Synthesis Kit (BioRad, Hercules, CA).
-
bioRxiv - Neuroscience 2019Quote: ... The RNA was converted into cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad) following manufacturer's instructions ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using the iScript Advanced cDNA Synthesis Kit (Bio-Rad, Hercules, CA), then preamplified using SsoAdvanced PreAmp Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and the commercially available iScript™ cDNA synthesis kit (Bio-Rad, Gladesville, NSW, Australia) in the presence of random hexamers and oligo(dT)s ...
-
bioRxiv - Immunology 2019Quote: ... Two micrograms of total RNA were reverse transcribed using iScript cDNA synthesis kit (BioRad) in a total volume of 20 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules CA) according to manufacturer’s recommendations using 1.0 µg of purified total RNA.
-
bioRxiv - Genomics 2021Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Microbiology 2021Quote: ... The autoradiography signals were visualized using ECL advance Western blotting detection kit (BioRad, USA).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using the iScript™ Reverse Transcription Supermix kit (Bio-Rad, #1708841).
-
bioRxiv - Physiology 2021Quote: ... Protein concentration in the lysates was estimated using Dc protein assay kit (Bio-Rad). The lysates (30 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... and retro-transcribed into cDNA by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad, Hercules, CA, USA) and primers listed in Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total protein of the samples was quantified using a Protein DC kit (Bio-Rad). β-Mercaptoethanol and loading dye was added to 125 µg of the samples ...
-
bioRxiv - Immunology 2020Quote: Reverse transcription of RNA was performed utilizing iScript cDNA Synthesis Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA was reverse transcribed (RT) using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Biorad PN170-8891) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Purified sfGFP was measured using a Quick Start Bradford Kit (BioRad, Hercules, CA, USA) in biological triplicate and technical triplicate.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated by using the Aurum total RNA mini kit (Bio-Rad) and treated with DNase (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were determined using the Bradford Protein Assay Kit (Bio-Rad, Hercules,CA). Equal amounts of protein were separated on 4-12% NuPAGE SDS gel (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total protein concentration was measured using a DC Protein Assay kit (Bio-Rad Laboratories) and 40μg of protein lysate per sample was loaded on 4-20% polyacrylamide gels (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... using iScript™ Reverse Transcription supermix for RT-qPCR kit (BIO-RAD Laboratories, USA) following manufacturer’s instructions at PCR conditions (priming at 25°C for 5min ...
-
bioRxiv - Microbiology 2020Quote: ... The iScript cDNA synthesis kit was used for reverse transcription (Biorad, Hercules, CA, USA). iTaq FAST SYBR Green Supermix with ROX (Biorad ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcription was carried out using iScript cDNA synthesis kit (170-8891, Bio-Rad) for mRNA targets and TaqMan Advanced miRNA cDNA synthesis kit (ThermoFischer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Synthesis of cDNA was accomplished using the iScriptTM cDNA Synthesis Kit (Bio-Rad®), and 1000 ng of RNA was used as the input for the cDNA synthesis of each sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, California) and qRT-PCR reactions were run on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... the reactivity of the colonies was detected using the Opti-4CN Substrate Kit (BIORAD), according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and used for reverse transcription with the iScript™cDNA synthesis kit (Bio-rad, Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using oligo-dT primers and iScript cDNA synthesis kit (BioRad, 1708891). Reverse transcription-quantitative Polymerase Chain Reaction (RT-qPCR ...
-
bioRxiv - Neuroscience 2022Quote: ... After determination of concentration with a standard protein assay kit (Bio-Rad, Hercules, CA), the cell lysates were subjected to immunoblot analysis using standard procedures and visualized by enhanced chemiluminescences (ECL) ...
-
bioRxiv - Neuroscience 2022Quote: ... Chemiluminescence detection was performed using Immun-Star WesternC Kit (Bio-Rad, Hercules, CA, USA), and the net intensities of each signal were quantified using ChemiDoc Imaging Systems (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... Purified RNA was retro-transcribed into cDNA with the iScript cDNA synthesis kit (Biorad). Expression of the Klf2 gene was quantified with RT-qPCR ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein concentration was estimated using the RC DC protein assay kit II (BioRad, 5000122) with BSA as reference ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined by a colorimetric assay (DC protein assay kit, BioRad). All samples were diluted to a protein concentration of 1.2 mg/ml in a total volume of 75 µl of RIPA and shipped to Eve Technologies (Calgary ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein concentrations were determined via Bradford assay (Bio-Rad Protein Assay Kit II; (75)) ...
-
bioRxiv - Genomics 2022Quote: ... mRNA extraction was performed using the Aurum™ Total RNA Mini Kit (Bio-Rad) as per the manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). To prepare supernatant western blotting samples of N/TERT-1 keratinocytes ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). The samples were separated by SDS-PAGE ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). Samples were run on NuPAGE 4 to 12% ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA synthesis was performed using iScript gDNA Clear cDNA synthesis kit (Bio-Rad) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Extracted proteins were further purified using the BioRad ReadyPrep 2-D Cleanup Kit (BioRad), approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad ...
-
bioRxiv - Plant Biology 2022Quote: Protein amounts were determined using the Bradford Assay Kit (Bio-Rad, Hercules, California, USA), and 6.0 μg of each protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Plant Biology 2022Quote: ... The total protein concentration was determined using a Bradford protein assay kit (Bio-Rad). Proteins were detected using anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... The total protein concentration was determined using a DC Protein Assay Kit (Bio-rad). For protein separation ...
-
bioRxiv - Microbiology 2022Quote: ... and the plasmid DNA was isolated using Quantum Prep®Plasmid Midiprep Kit (Biorad) according to the manufacturer’s’ instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Total protein amount was determined by DC™ Protein Assay Kit II (Bio-Rad), then lysates were loaded on 4-15% Mini-PROTEAN TGX Stain-Free Protein Gels (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesised with the iScript cDNA Synthesis kit (#1708891, Bio-Rad Laboratories) according to the manufacturers’ instructions ...