Labshake search
Citations for World Precision Instruments :
901 - 950 of 3781 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 500 nl of HisLightG was infused at a rate of 100 nl / minute using a Nanofil syringe with 33 g blunt needle and UMP3 microsyringe pump (WPI; Sarasota, FL, USA). The needle remained in place for 10 min to allow the virus to diffuse ...
-
bioRxiv - Neuroscience 2024Quote: ... and a microsyringe pump controller (UltraMicroPump III, World Precision Instruments). For dHPC injections ...
-
bioRxiv - Neuroscience 2024Quote: ... pulled with a P1000 horizontal puller (World Precision Instruments, Sarasota, USA) to a final resistance of 3.5 – 5 MΩ ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were patched using borosilicate glass pipettes (TW150F-4) (World Precision Instruments, Sarasota, USA) pulled with a P1000 horizontal puller (World Precision Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... Injections were made using a Micro4 controller and UltraMicroPump along with a 10 µl Nanofil syringes equipped with 33-gauge needles (WPI Inc., Sarasota, FL). The syringe was left in place for 10 minutes after injection to minimize diffusion ...
-
bioRxiv - Neuroscience 2024Quote: ... The stimulus was delivered using a stimulus isolator unit (A365, World Precision Instruments) with current pulse amplitudes set at twice the threshold intensity of stimulation (2T ...
-
bioRxiv - Neuroscience 2024Quote: ... The electrode tip was refined with a microforge (MF200; World Precision Instruments, FL, USA). Sharp-electrodes (120 − 190 MΩ ...
-
bioRxiv - Neuroscience 2024Quote: ... The electrode was prepared for electrophysiological recording through standard backfilling of the internal electrode solution by using a microfiller (MF34G MicroFil; World Precision Instruments). The internal pipette solution loaded into the tip contained 102 mM potassium gluconate ...
-
bioRxiv - Neuroscience 2024Quote: ... a Hamilton syringe (34G or 35G needle size; NanoFil syringe, World Precision Instruments) was inserted with the use of a micromanipulator (David Kopf Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µl of viral vector dispersion was injected at a rate of 150 nl/min with a microinjector pump (UMP3-1, World Precision Instruments). After each injection ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected in the lateral ventricles of each embryo using a glass capillary (World Precision Instruments) sharpened previously by Puller P-97 (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2024Quote: ... Injections were made at depths of 200 and 350 μm below the pial surface using glass pipettes and a microinjection system (UMP3 UltraMicroPump, WPI). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... Lenses were secured to the skull using cyanoacrylate glue and dental cement and covered with Kwik-Sil (WPI). Two to three weeks later ...
-
bioRxiv - Genetics 2024Quote: ... and an automated infusion pump (World Precision Instruments, Sarasota, FL) was used to inject the viruses at 3 nl/sec for a total volume of 600 nl/hemisphere in the FC (1.7 mm ventral to the surface of the brain ...
-
bioRxiv - Neuroscience 2024Quote: ... Viruses were injected into the targeted brain regions using glass capillaries and a nanoinjector (World Precision Instruments, Nanoliter) at 10 nL/min.
-
bioRxiv - Neuroscience 2024Quote: ... Virus was injected using an Ultra Micro Pump (UMP3, WPI, USA) connected to a microcontroller (MICRO2T ...
-
bioRxiv - Neuroscience 2024Quote: ... Kwik-Sil (#KWIK-SIL, WPI), was mounted surrounding the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... and -1.45 D/V from bregma) at a rate of 20nL/min using a microsyringe pump (UMP3 UltraMicroPump, Micro4; World Precision Instruments, Sarasota, FL). A 1.25mm ceramic ferrule (core 200µm ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were loaded into in-house prepared golden-coated borosilicate glass capillaries (1B120F-4, World Precision Instruments) and electrosprayed into a Waters Synapt G2Si mass spectrometer ...
-
bioRxiv - Bioengineering 2024Quote: ... the prepared solution was extruded at the rate of 1 mL/h using a syringe pump (World Precision Instruments, Sarasota, Florida, USA) through a 27G nozzle under the voltage of 13 kV applied to the nozzle ...
-
bioRxiv - Bioengineering 2024Quote: ... TEER was measured using an EVOM2 epithelial Volt/Ohm meter (World Precision Instruments, USA) equipped with an STX3 pair of electrodes ...
-
bioRxiv - Bioengineering 2024Quote: ... VCCE is performed at a constant volume rate (CVR) expansion2 of 600 nL/s using a World Precision Instruments (WPI) UltraMicroPump3 controlled via a custom script input to a WPI SMARTouch Controller as detailed by Unikewicz et al ...
-
bioRxiv - Bioengineering 2024Quote: ... Goodfellow) was drawn into a glass capillary (1.0 mm outer diameter, 0.58 mm inner diameter; World Precision Instruments) and pulled using a PE-22 micropipette puller (Narishige Group ...
-
bioRxiv - Biochemistry 2024Quote: ... The flow rate was controlled with a syringe pump (Legato; World Precision Instruments) at typically 20 µL/min ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were plated for imaging in glass bottomed 35mm dishes (FluoroDish, World Precision Instruments, Hitchin, UK) at a density of 300,000 per dish.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The plastic coverslip was sealed on the cuticle with two-component silicon (Kwik-Sil, World Precision Instruments) leaving the proboscis exposed to the air ...
-
bioRxiv - Biophysics 2024Quote: ... A round glass capillary (15.24 cm long with an outer diameter of 1.0 mm and inner diameter of 0.580 mm, World Precision Instruments, Sarasota, FL) and a square capillary (with an internal width of 1.0 mm ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were grown in 35-mm imaging plates (FluoroDish WPI; IBIDI). An inverted Eclipse Ti-E (Nikon ...
-
bioRxiv - Cancer Biology 2024Quote: BUVEC-E6E7 monolayers were grown on the top of a transwell insert with 0.4 μm pores and transendothelial electrical resistance (TEER) was measured using an EVOM2 Volt/Ohm resistance meter (World Precision Instruments, Sarasota, FL, USA) as previously reported [4] ...
-
bioRxiv - Biophysics 2024Quote: ... inside-out mode were made with glass pipettes (WPI) that were that were generated with an electrode puller (Sutter Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... 700 µm in depth) via a glass pipette mounted on a Nanoliter injector (NANOLITER-2020, WPI, Florida, USA) at a rate of 0.2 µl per minute ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were injected into mice by a 33-gauge Hamilton syringe controlled by a Micro4 microsyringe pump (World Precision Instruments). Cells were injected at a rate of 1 μL/min and 0.5 μL was injected per site ...
-
bioRxiv - Neuroscience 2024Quote: ... The exposed brain was sealed with Kwik-Sil (World Precision Instruments), and a thin layer of tissue glue was applied to lightly seal the medial edge of the grid to the skull ...
-
bioRxiv - Biophysics 2024Quote: ... The micropipette was filled with the same buffer used in microscopy experiments (150 mM NaCl, 20 mM Tris-HCl, pH 7.5) using a MICROFIL needle (World Precision Instruments). The filled micropipette was then mounted onto a micromanipulator ...
-
bioRxiv - Biophysics 2024Quote: ... the pipette was bent to an angle of approximately 40° using a microforge (DMF1000, World Precision Instruments).
-
bioRxiv - Biophysics 2024Quote: ... Micropipettes were made by pulling glass capillaries using a pipette puller (PUL-1000, World Precision Instruments). The pipette tip was then cut to achieve an opening diameter ∼5 μm ...
-
bioRxiv - Biophysics 2024Quote: ... and STX2 chopstick electrode (WPI) and normalized by the surface area of the monolayer ...
-
bioRxiv - Cancer Biology 2024Quote: ... the microelectrode was mounted to a piezo-driven xyz micromanipulator (SN-PCZ-50R, WPI) located in an environmental chamber (37 ° C ...
-
bioRxiv - Cancer Biology 2024Quote: Laplace pressure measurements were conducted using the 900A micro pressure system (WPI) based on the servo-null method ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were plated either onto #1.5 glass-bottom 35 mm dishes with 23 mm well coated with poly-D-lysine (FD35PDL, World Precision Instruments, Inc.) for confinement experiments (Fig ...
-
bioRxiv - Cell Biology 2024Quote: ... Morpholino delivery was achieved using a PV830 Pneumatic PicoPump and MICRO-ePore (World Precision Instruments). Injection volume was estimated by ooplasm displacement and was typically in the range of 0.25% cell volume.
-
bioRxiv - Bioengineering 2024Quote: ... in PBS was loaded onto an AL1010 syringe pump (World Precision Instruments). A second syringe containing mineral oil (Merck M8410 ...
-
bioRxiv - Cell Biology 2024Quote: U2OS cells were seeded in 35 mm glass-bottom dishes (World Precision Instruments) and allowed to adhere overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... EMG signals were recorded during electrical and ultrasound stimulation of the gastrocnemius muscle through the recording electrode connected to an isolated bio-amplifier (WPI) of 103 gain and band-pass filtered from 10 Hz to 3 kHz (Figure 1B).
-
bioRxiv - Bioengineering 2024Quote: ... Pupils were dilated and 1 µL subretinal injections were performed at P14 using a Hamilton syringe with a 33-gauge blunt needle (World Precision Instruments) under an operating microscope (Leica Microsystems) ...
-
bioRxiv - Bioengineering 2024Quote: ... fully enclosing the device with a biocompatible adhesive (Kwik-Sil, WPI). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... PDOs were subsequently seeded to form BME domes into 35mm glass-bottom FluoroDish® plates (World Precision Instruments) as described above ...
-
bioRxiv - Cell Biology 2024Quote: STX4 EVOM electrodes connected to an EVOM 2 electrical impedance reader (both World Precision Instruments) were used to measure electrical resistance in ohms (Ω) ...
-
bioRxiv - Cell Biology 2024Quote: ... and and approximately 450 nl of DNA solution was injected into the subretinal space using a 33G blunt needle connected to a UMP3 microinjection syringe pump and MICRO2T controller (World Precision Instruments). Five 50-ms pulses of 80V were applied across the eyes at 1-s intervals using tweezer electrodes and a square wave electroporator (ECM830 ...
-
bioRxiv - Cell Biology 2024Quote: ... and injected into zebrafish zygotes prior to the first cell division using a uPUMPmicroinjector (World Precision Instruments). The standard control morpholino (5’– CCTCTTACCTCAGTTACAATTTATA–3’ ...