Labshake search
Citations for New England Biolabs :
301 - 350 of 2182 citations for Transcription Factor SOX 10 SOX10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antisense digoxigenin-labelled RNA probes were then obtained by in vitro transcription using T7 RNA polymerase (New England Biolabs) and digRNA labelling mix (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and directly used for in vitro transcription of single-guide RNAs (sgRNAs) with a T7 Polymerase mix (M0255A NEB). All sgRNA reactions were treated with RNAse free-DNAse ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 ng of gel or PCR purified DNA was used as a template for in vitro transcription (NEB E2040S) carried out according to the manufacturer’s instructions with the addition of 0.1μl of Cy3 (Sigma PA53026 ...
-
bioRxiv - Molecular Biology 2021Quote: ... in vitro transcription was performed to produce sgRNAs using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). Next ...
-
bioRxiv - Physiology 2020Quote: ... cDNA was then synthesized from 1μg RNA template through reverse transcription using Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs), as recommended by manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and RNAse free water and lastly 1.5 μL of T7 RNA polymerase (HiScribe T7 In Vitro Transcription Kit from New England Biolabs or AmpliScribe T7 High Yield Transcription Kit from Epicenter) ...
-
bioRxiv - Genomics 2019Quote: ... The template was then used for in-vitro transcription using the HiScribe T7 High Yield RNA synthesis kit (NEB). The in-vitro transcription reaction was carried out at 37°C for 16 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... The mRNAs were fragmented and converted into double-stranded DNA by reverse transcription and then second-strand synthesis (NEB). The DNA fragments were amplified by PCR and ligated into the pro-siRNA library vector pET30 (Kaur et al. ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... UK) were then synthesized through in vitro transcription of 1 mg template with T7 polymerases (M0251, New England Biolabs). The sections were fixated in 4% PFA ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcription of gRNA was performed using the T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S) and generated gRNA was purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... Templates for in vitro transcription were generated by PCR-amplification using Q5 Polymerase (New England Biolabs, Cat No. M0491S).
-
bioRxiv - Microbiology 2019Quote: ... The reverse transcription was followed by PCR amplifications using the Q5® high-fidelity DNA polymerase (New England Biolabs) with primers amplifying two overlapping fragments per RNA segment ...
-
bioRxiv - Cell Biology 2021Quote: sgRNAs were generated by in vitro transcription using the Hiscribe T7 high yield RNA synthesis kit (New England Biolabs). Purified sgRNA (0.5 μg ...
-
bioRxiv - Molecular Biology 2019Quote: All mRNAs were synthesized by T7 RNA polymerase in vitro transcription reaction (IVT) (New England Biolabs cat. no. M0251L) and purified using standard techniques ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg of total RNA was used in cDNA synthesis using ProtoScript II Reverse Transcription kit (NEB, Cat # e6560) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was amplified for transcription by PCR using custom DNA primers and Phusion Hot Start polymerase (New England BioLabs). Transcription reactions were conducted using 500 μL PCR reactions as template into 5 mL transcriptions ...
-
bioRxiv - Molecular Biology 2021Quote: PCR products were subject to in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (E2040S, NEB), which relies on the T7 RNA polymerase to initiate transcription from a T7 promoter sequence (present in our fragments) ...
-
bioRxiv - Bioengineering 2022Quote: ... In vitro transcription was performed using HiScribe™ T7 or SP6 High Yield RNA Synthesis Kit (New England Biolabs). RNA was subsequently purified using Monarch® RNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Biochemistry 2022Quote: ... The beads were covered with 30 μL of reverse transcription mixture containing dNTPs (0.5 mM each, New England BioLabs), acetylated BSA (1,5 μg) ...
-
bioRxiv - Microbiology 2022Quote: ... ShdA III and ShdA IV homologues were synthesised in vitro using the PURExpress cell-free transcription/translation kit (NEB), from PCR products ...
-
bioRxiv - Molecular Biology 2022Quote: ... and in vitro transcription was performed using the HiScribe T7 ARCA mRNA Kit (New England Biolabs, Ipswich, MA, USA) to generate IVT mRNA according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... quantitative reverse transcription PCR (qRT-PCR) was conducted using Luna universal probe one-step RT-PCR kit (NEB, #E3006) on CFX96 Touch Real-Time Detection System on 96-well plates (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... nLuc plasmids were linearized using SpeI and subjected to in-vitro transcription using HiScribe T7 kit (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs were generated by in vitro transcription using the HiScribe T7 high-yield RNA synthesis kit (New England Biolabs). Purified sgRNA (0.5 µg ...
-
bioRxiv - Synthetic Biology 2023Quote: ... In vitro transcription of sgRNAs was performed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA and quantitative PCR was performed using the Luna Universal One-step RT-qPCR Kit (NEB) using 1 µg of RNA per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... T7 transcription was performed for 16 h and then RNA was purified using the Monarch RNA Cleanup Kit (NEB). In vitro cleavage was performed with purified recombinant ...
-
bioRxiv - Developmental Biology 2024Quote: ... and both reverse transcription and PCR were performed using the Luna One-Step Universal RT-qPCR kit (NEB, E3005S) and carried out on the Mic qPCR Machine (BioMolecular Systems ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transcription cDNA synthesis was performed using NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB, E6421). Samples were barcoded and the library pool was prepared according to the guidelines laid out in the Iso-Seq protocol version 02 (PacBio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... In vitro transcription (IVT) eactions were performed with HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs). Template DNA was degraded with TURBO DNase (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The gRNA was made by in vitro transcription using a Hiscribe T7 high yield kit (New England Biolabs #E2040s) using the following primers (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Plant Biology 2023Quote: ... In vitro transcription was performed using the HiScribe T7 ARCA mRNA (with tailing) kit (New England Biolab, http://www.NEB.com) and Xenopus oocytes were injected with 30 ng of RiSKC3 cRNA using a pneumatic injector ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and +1 sites of the promoters controlling transcription of both RNAs were used to amplify the standard pUC19 plasmid (NEB). After PCR amplification samples were digested with DpnI (NEB ...
-
bioRxiv - Immunology 2021Quote: ... The template for in vitro transcription was a PCR amplicon from the pLMCT-RBD-6His produced using the PHUSION high fidelity DNA polymerase (NEB) and TGTGGAATTGTGAGCGGATA as forward primer and CTTCACTATTGTCGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA as reverse primer.
-
bioRxiv - Microbiology 2021Quote: ... was added to in vitro transcription reactions according to the HiScribe T7 Quick High Yield RNA Synthesis Kit protocol (New England Biolabs). RNAs were included in phase separation assays at a final concentration of 16 nM (500:1 protein:RNA ratio).
-
bioRxiv - Developmental Biology 2020Quote: ... Fragmentation of mRNA followed by reverse transcription and second strand cDNA synthesis was done using NEBNext Ultra RNA Library Prep Kit for Illumina (E7530, NEB). Sequencing libraries were constructed using ThruPLEX DNA-seq kit (Takara R400428) ...
-
bioRxiv - Molecular Biology 2022Quote: ... which were subsequently transcribed to produce copies of the mRNAs using an in vitro transcription kit (New England Biolabs, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... library sequence and terminator was PCR amplified to serve as template for in vitro transcription (NEB HiScribe T7 kit, USA). The PUREfrex 2.0 system (GeneFrontier Corporation ...
-
bioRxiv - Genomics 2020Quote: ... In vitro transcription was performed using HiScribe T7 high yield RNA synthesis kit according to the manufacturer’s protocol (NEB, E2040S). In vitro synthesized RNAs was treated with 10U RNAse-free DNAse I (ThermoFisher Scientific ...