Labshake search
Citations for New England Biolabs :
201 - 250 of 2336 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Biophysics 2020Quote: ... from human origin were all purchased from NEB. The H2A/H2B and H3.1/H4 were mixed in 2(H2A/H2B)2:1(H3/H4)4 molar ratio to form octamers.
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Molecular Biology 2019Quote: ... where C-terminal Myc-DDK tag was replaced by HIS-V5 tag using a NEBuilder HiFi DNA assembly kit (New England Biolabs). SHIP2 deletion in 293T cells was carried out by CRISPR/Cas9 technology (Ran et al ...
-
bioRxiv - Bioengineering 2019Quote: ... inserting a N-terminal TEV cleavage tag and cloned into a pET28a backbone in front of the His-tag using the NEBuilder HiFi DNA assembly method (NEB).
-
bioRxiv - Biochemistry 2019Quote: ... fused to a His-ZZ-TEV tag on the amino-terminus and a carboxy-terminal SNAPf tag (New England Biolabs)) and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Vectors containing cohesin trimers were generated by combining pACEbac1 SMC1-His SMC3 with pIDC SCC1-2xStrepII by a Cre recombinase reaction (New England Biolabs). The vector for the Scc2/4 expression was also created by combining the pACEbac1 SCC2-2xStrepII with pIDC His-SCC4 using Cre recombinase.
-
bioRxiv - Immunology 2021Quote: ... Restriction digest of pMK-RQ plasmid DNA containing EtIMP1 was performed using Bam HI and Not I restriction enzymes (New England Biolabs). Restriction digest of pYD1-EtAMA1Cit plasmid was performed with the same restriction enzymes to remove the EtAMA1 insert but retain the citrine tag ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tagmented DNA was amplified with 12 cycles of PCR using the NEBNext Hi-Fi 2X PCR Master Mix (NEB M0541) and unique dual index primers ...
-
bioRxiv - Cell Biology 2021Quote: ... coding sequence was amplified from Arabidopsis cDNA and assembled into a pGreen0179-35S-spFLA11-His-YFP vector using NEBuilder HiFi DNA Assembly kit (NEW ENGLAND Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... open reading frames were cloned into a linearized pET28b vector with BamH1 and Xho1 in frame with a N- terminal 6x-His tag using Gibson HiFi assembly mix (NEB), 10 μL total reaction volume with 2 μL of linearized vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Constructs HsKHC-MDC and HsKHC-MDCL2-CaKip3 contained a cleavable C-terminal TEV-SNAP-6X-His tag (SNAP-tag from NEB). DARPin-D2 was ordered as a codon-optimized gene product from IDT and cloned into pET16b using Gibson Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Biophysics 2022Quote: ... was further amplified by PCR with an overlapping sequence with pGEX-6P and cloned immediately after the PreScission site of the pGEX-6P vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biophysics 2022Quote: ... with the (G4S)4-GGS linker was amplified by PCR by adding a linker sequence and inserted into the pGEX-6P vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... containing the protospacer sequence and sequences that overlap with pMH-Cas9 were assembled into pMH-Cas9 using Hi-Fi DNA Assembly Mastermix (NEB). The Hi-Fi reaction was transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... GST aPKC PBM and his aPKC kinase domain-PBM (residues 259-606) were cloned as previously described (10) using Gibson cloning (New England BioLabs), Q5 mutagenesis (New England BioLabs ...
-
bioRxiv - Genetics 2019Quote: ... The donor sequence was generated by subcloning 596 bp upstream of the hrpk-1 stop codon and 600 bp downstream of hrpk-1 stop codon into the pDD282 vector [45] using Hi Fi assembly kit (NEB). The hrpk-1 stop codon was eliminated from the donor sequence to allow in frame GFP tag addition ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Insert NGRP or scFv13R4 was assembled into backbone pDEST-ORS-PelB TMT following NEB builder Hi-fi mix protocol (NEB) to create pDEST-ORS-NGRP/scFv13R4 TMT ...
-
bioRxiv - Microbiology 2021Quote: ... and cloned to the C terminus of a 11 His-tagged maltose-binding protein in a pMAL-C5X vector (New England Biolabs) separated by a cleavage site for tobacco etch virus protease ...
-
bioRxiv - Cell Biology 2022Quote: ... EIF2AK2 and EIF2S1 sequences were inserted into pET-His 1a vector using the Gibson Assembly Cloning Kit (New England Biolabs) as described by the manufacturer.
-
bioRxiv - Cell Biology 2021Quote: The pDyn1 plasmid (the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to a His-ZZ-TEV tag on the aminoterminus and a carboxy-terminal SNAPf tag (New England Biolabs)) and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and ligated to linearized vector pGex-6p-1 (GST) or pET28-SUMO (His) also cut with the same restriction enzymes using T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... a construct was cloned by PCR from the LacZ gene of Escherichia coli MG1655 with a His-tag on the C terminus by Gibson Assembly (New England Biolabs) in a pET-28b vector using the following primers LacZ200 (TAACTTTAAG AAGGAGATAT ACCATGACCA TGATTACGGA TTCACTGGCC GTCGTTTTAC ...
-
bioRxiv - Biochemistry 2022Quote: ... a tolerant position was mutated to facilitate making a labeled LexA variant.56 The His-LexA W201C mutant was generated using a Q5 Site-Directed Mutagenesis Kit (NEB) and the mutation was confirmed via sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... The resultant adaptor-ligated Hi-C library was amplified by PCR with five to seven cycles with Q5 master mix (M0544, NEB) and index primers (E7335/E7500/E7710/E7730 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ebony non-coding regions from different species were amplified via PCR and cloned into the S3AG vector using NEBuilder Hi-Fi DNA assembly (NEB) (Table X) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... melanogaster strain to be injected and inserted into plasmids containing fluorescent eye markers using NEBuilder Hi-Fi DNA assembly (NEB). See key resources table for primers sequences and donor plasmids.
-
bioRxiv - Microbiology 2023Quote: ... was used as a template for in vitro transcription using Hi-T7 RNA Polymerase and Ribonucleotide Solution Mix (both from New England Biolabs) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads: glutathione-agarose beads from ROTH; MBP beads: amylose beads from NEB). Protein-binding beads were collected by centrifugation and washed several times with washing buffer (His washing buffer ...
-
bioRxiv - Genetics 2023Quote: ... The final cleaned-up Hi-C library was used as input material for Illumina sequencing library prep kit (NEB, E7805) with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... by PCR amplification with the indicated primers (Key Resources table) followed by a digestion with Bam HI and Xba I enzymes (New England Biolabs) for 37°C 2 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... linker was inserted into the pC13N-iCAG.copGFP vector through BsrGI and MluI digestion and Hi-T4™ ligation (Cat.#M2622; New England Biolabs), thus replacing copGFP and generating the pC13N_N-HiBiT plasmid ...