Labshake search
Citations for New England Biolabs :
451 - 500 of 2336 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids encoding HA-tagged LC3B proteins were generated by replacing the EGFP sequence in the EGFP plasmids with an HA-tag followed by a Tobacco etch virus protease sequence recognition site and a Flag-Tag (Genewiz) using AgeI and HindIII (New England Biolabs). Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Biochemistry 2022Quote: ... trcP or fragments of the trcP ORF were cloned into pHL100’s SmaI site with the 23 nt upstream sequence and the Flag tag sequence on the C-terminal using NEBuilder HiFi DNA Assembly Master Mix (NEB); subsequently ...
-
bioRxiv - Cell Biology 2019Quote: ... the eGFP-FLAG-HA-MLKS2 sequence was PCR amplified with att flanking primers (Table S2) using high fidelity Q5 polymerase (NEB) and cloned into pDONR221 vector by BP cloning (Cat ...
-
bioRxiv - Biochemistry 2019Quote: ... were generated as described previously.23 In vitro transcription/translation of (fMVF-Flag was carried out using the combination of PureExpress (ΔtRNA, Δaa (E6840S)) and PureExpress (Δribosome (E3313S)) kits (NEB) with the following modifications ...
-
bioRxiv - Cancer Biology 2020Quote: The Flag-HA-USP18WT construct was purchased from Addgene (#22572) and the Flag-HA-USP18C64R/C65R construct was generated using the Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers OL87 ...
-
bioRxiv - Cell Biology 2021Quote: ... A 12xHis tag was cloned into the N-terminus of pcDNA3.1-MICAL1-FLAG using Q5® Site-Directed Mutagenesis Kits (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cloned into a pLenti-hygro backbone to create pLenti hygro Myr FLAG AKT1 (CA AKT) using standard Gibson cloning (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The pACEbac1 XSMC1 XSMC3-Halo-Flag and pIDC XRAD21-8xHis were then combined by a Cre recombinase reaction (New England Biolabs). To generate the baculoviruses ...
-
bioRxiv - Cell Biology 2022Quote: ... To generate pcDNA5/FRT-Tg-NLuc plasmids the Tg gene was amplified from the pcDNA5/FRT-Tg-FLAG plasmid and assembled with the NLuc fragment using a HiFi DNA assembly kit (New England BioLabs). To generate the respective mutant construct plasmids for A2234D and C1264R Tg ...
-
bioRxiv - Neuroscience 2022Quote: ... and MATR3(S85C) from pGW1 FLAG-MATR3-EGFP constructs61 using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and flanking primers that eliminated linker sequences and EGFP ...
-
bioRxiv - Microbiology 2022Quote: ... which was assembled with oligo DNA containing Myc or FLAG tag sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The resultant plasmids were named pcDNA3-C-Myc or pcDNA3-C-FLAG ...
-
bioRxiv - Neuroscience 2023Quote: The EEF1A2 CDS was cloned into pcDNA3.1-FLAG (gift from Saunders Lab) using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the protocol of the manufacturer ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Microbiology 2023Quote: Epitope-tagged constructs using the GST tag or the 3X FLAG tag were generated using the HiFi DNA Assembly cloning kit (NEB). MntS was cloned into pGEX-6-1 and the GST-MntS fusion was subcloned into pKT25c such that the resulting plasmid lacked the T25 region ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and the GeneArt Gibson Assembly HiFi Master Mix (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc, Ipswich, MA, Cat #M0541S). Following PCR ...
-
bioRxiv - Genomics 2019Quote: ... were ligated onto Hi-C ligation products bound to streptavidin beads for 2 hours at room temperature (T4 DNA ligase NEB, in ligation buffer, slowly rotating). After washing twice with wash buffer (5 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...