Labshake search
Citations for New England Biolabs :
101 - 150 of 2336 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Microbiology 2023Quote: ... His/Strep-Tag was cleaved using enterokinase according to the protocol of the manufacturer (NEB) and GlnA3Mtwas immediately purified from the digestion mix by size-exclusion chromatography as directed by the resin manufacturer (GE-Healthcare).
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Genetics 2019Quote: ... Flag-Mad-8 was generated by PCR followed by Gibson assembly (NEB) and the S359L substitution was verified by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... DmMIC10b(C64S)-FLAG were produced using the Site-Directed Mutagenesis Kit (NEB) and the oligonucleotides given below.
-
bioRxiv - Immunology 2021Quote: ... In-vitro-transcription was carried out using the Hi-Scribe RNA transcription kit (New England BioLabs). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrations measured using Qubit 1X dsDNA HS Assay) was treated with 5U of RNAse HI (NEB) in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ENTR and DEST vectors were generated using Gibson assembly (NEB Builder Hi-Fi DNA assembly #E2621S) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of His-PKR was dephosphorylated using 3,200 units of λ-PPase (New England Biolabs) in 200 μl reaction buffer (50 mM HEPES ...
-
bioRxiv - Plant Biology 2022Quote: ... The HIS tag was removed from the mature sequence of AgLTP24 with enterokinase (NEB, Evry, France) for 16 h at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Hi-C single-index library preparation was performed as previously described56 using MboI (New England Biolabs) restriction enzyme.
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Microbiology 2024Quote: ... Tags (6x His or HA) were introduced using site-directed mutagenesis with KLD enzyme mix (NEB).
-
bioRxiv - Biochemistry 2020Quote: ... and m7G(5′)ppp(5′)A (NEB, #S1405S) also referred throughout the manuscript as N7-meGpppG and N7-meGpppA for consistency ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL RNase H (5 U/µL, NEB), 2.5 µL RNase III (1 U/µL ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG expression construct was PCR-amplified from cDNA with Phusion polymerase (NEB) with primers CACCATGACTGAGCAGATGACCCTTCGTG TTATCACTTATCGTCGTCATCCTTGTAATCGCGTGTGCCAATGGTCACCTGC CAC and cloned into pENTR D-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: Myc- and DDK (FLAG)-tagged Hemopexin mRNA was transcribed from an AgeI (NEB) linearised plasmid using T7 RNA polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... by insertion of a second Flag using Gibson assembly (New England BioLabs, E5510S). The legK1 coding sequence was then inserted from pENTR/D-TOPO-LegK1 into p2xFlag through the GATEWAY technology ...
-
bioRxiv - Molecular Biology 2023Quote: pAC8-FLAG-SHLD3 truncation plasmids were generated using Gibson cloning (New England Biolabs) and a pAC8-FLAG-SHLD3 template (Setiaputra et al. ...
-
bioRxiv - Evolutionary Biology 2020Quote: Purified DNA library (250 ng) was cut with the Hind III and Bam HI restriction enzymes (NEB) for 1h at 37 °C in a reaction mixture containing 1X of the NEB cut smart buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Genomics 2020Quote: ... We put the mutagenized genes in a pIVEX vector via Gibson assembly (NEB Hi-Fi DNA assembly) using 125ng of gene DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and C-terminal additions) were assembled with the pcDNA5 backbone using Hi-Fi DNA assembly (NEB; E2621S).
-
bioRxiv - Plant Biology 2022Quote: ... His-TAD1 fusion proteins were purified according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA, USA). The bait protein GST-WL1 was incubated with GST beads (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The His-GST tags were cleaved by incubating the pooled fractions with TEV protease (New England Biolabs) at 4°C for 16h ...
-
bioRxiv - Genetics 2019Quote: ... 2012) by removing cbr-Pmyo-2∷gfp∷his-72 UTR by cutting using KpnI and ApaI (NEB). The digested pZZ0031 backbone carrying cbr-unc-119(+ ...
-
bioRxiv - Bioengineering 2022Quote: ... The t-NLuc-His tag was double-digested with NdeI and XhoI restriction enzymes (New England BioLabs), and the RNA sensor region were digested with SgrAI and SacII restriction enzymes ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were constructed in the pUC19 backbone using NEBuilder Hi-Fi DNA Assembly Mastermix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl Taq 5× Master Mix (New England Biolabs) and 18 µl Milli-Q water (18.2 MΩ cm) ...
-
bioRxiv - Developmental Biology 2023Quote: ... then capped with m7G(5’)ppp(5’)G (NEB) and tailed with a poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... Desialylation of ACE2-wt-Fc was performed with 2500 U mL-1 neuraminidase (New England Biolabs) in 50 mM sodium citrate (pH 5.0 ...
-
bioRxiv - Cell Biology 2022Quote: ... Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B, P6010, NEB) with or without 1 mM CX4549 (S2248 ...
-
bioRxiv - Biophysics 2021Quote: MukF Flag-tagged fragments were expressed from pET 21 plasmids in C3013I cells (NEB).The Flag-tagged MukE and MuF were at the C-terminus ...
-
bioRxiv - Cell Biology 2022Quote: ... FLAG-MBOAT7 was cloned into the lentiviral vector pRH115-mCherry linearized with XbaI (NEB) and BamHI (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...