Labshake search
Citations for New England Biolabs :
251 - 300 of 1275 citations for Recombinant Human CD28 protein Biotin labelled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The new SNAP-tagged histones synthesized during the chase were fluorescently labelled with 2 µM of the red-fluorescent reagent SNAP-cell TMR star or SiR-647 (New England Biolabs) during a 15 min-pulse step followed by 30 min wash in fresh medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ ends of ds-probes were radioactively labelled with [ψ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs), purified on Illustra Microspin G-25 columns (GE) ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The new SNAP-tagged histones synthesized during the chase were fluorescently labelled with 4 μM of the green-fluorescent reagent SNAP-cell Oregon green (New England Biolabs) during a 15-min pulse step followed by 30-min wash in fresh medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SNAP-tagged histones neosynthesized during the chase time were then pulse-labelled by incubating cells with 2 μM of the red-fluorescent SNAP reagent SNAP-cell TMR star (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... An aliquot of 15 μl containing trimer with fluorescently labelled glycans was treated with Endo H overnight at 37°C (New England Biolabs). Glycans were extracted with a polyvinylidene-fluoride protein-binding membrane (Merck Millipore) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were labelled with 100 nM Halo-TMR ligand and 100 nM SNAP-Cell 647-SiR ligand (New England Biolabs) for 20 min ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were then mixed with Blue Protein Loading Dye (NEB) boiled for 10 minutes and separated on 10% SDS-PAGE gel for 50 minutes at 140 V ...
-
bioRxiv - Plant Biology 2021Quote: ... and extracted nuclear proteins were treated with lambda protein phosphatase (NEB) according to the manufacturer’s instruction.
-
bioRxiv - Genomics 2020Quote: ... Endogenous proteins were captured onto protein G-magnetic beads (NEB; #S1430S), washed extensively in IP buffer and used for POT1wtand POT1V29L source ...
-
bioRxiv - Cancer Biology 2019Quote: ... Biotin was removed from non-ligated restriction fragment ends by incubating 40μg of DNA with T4 DNA polymerase (NEB) for 4 hours at 20°C in the presence of dATP and dGTP ...
-
bioRxiv - Molecular Biology 2019Quote: ... we incubated the Pol II EC(CPD) (with and without biotin crosslinking) with 2μl streptavidin magnetic beads (NEB, USA) for 30 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Genetics 2020Quote: ... Open chromatin DNA was labeled with biotin by incubating the nuclei in presence of 2.5 U of Nt.CviPII (NEB, R0626S), 50 U of DNA polymerase I (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... new SNAP-tagged histones were pulse-labeled for 30 min with 5 μM final SNAP-biotin (New England Biolabs) diluted 1:200 in 10% Duolink blocking buffer (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... from human origin were all purchased from NEB. The H2A/H2B and H3.1/H4 were mixed in 2(H2A/H2B)2:1(H3/H4)4 molar ratio to form octamers.
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Biochemistry 2019Quote: ... Three replicates of each condition were subjected to fluorescent PCR with a FAM-labelled forward primer (below) and with Phusion polymerase (NEB #M0530S) for 32 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... corresponding to both strands of the 35S rRNA promoter from positions −180 to −110 and −110 to −40 were end-labelled using [γ-32P]ATP and T4 polynucleotide kinase (New England Biolabs) and purified on a 10% acryl/bisacrylamide ...
-
bioRxiv - Biochemistry 2022Quote: ... the used RNA was radioactively labelled on the 5’-end with [γ-32P]ATP (10 mCi/ml, Hartmann Analytic) and T4 PNK (NEB), following purification via PAGE ...
-
bioRxiv - Cell Biology 2019Quote: 40pmol of single stranded oligonucleotide was labelled at the free 5’-OH group with 20 units of T4 polynucleotide kinase (NEB # M0201) in a 50 μl reaction volume containing 1X polynucleotide kinase buffer and 30 μCi γ32P ATP at 37°C for 30min ...
-
bioRxiv - Cell Biology 2020Quote: A synthetic miR-409-5p oligo was 5’ end-labelled with γ-P32 ATP using T4 polynucleotide kinase (New England Biolabs) and purified using G-50 columns ...
-
Genomic local adaptation of a generalist plant species to pollinator communities and abiotic factorsbioRxiv - Plant Biology 2022Quote: ... The nicked DNA was labelled with a fluorescent-dUTP nucleotide analogue using Taq DNA polymerase (New England BioLabs, cat. no. M0267S). After labelling ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the annealed substrates was 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (New England Biolabs). For fluorescently labeled HJ40 substrates ...
-
bioRxiv - Genetics 2021Quote: ... on DNA were performed in the buffer supplied with the commercial recombinant enzyme (New England Biolabs (NEB) dam Methyltransferase Reaction Buffer or CutSmart Buffer ...
-
bioRxiv - Genetics 2021Quote: ... on DNA were performed in the buffer supplied with the commercial recombinant enzyme (New England Biolabs (NEB) dam Methyltransferase Reaction Buffer or CutSmart Buffer ...
-
bioRxiv - Immunology 2020Quote: ... The amplified DNA was then treated with recombinant Shrimp Alkaline Phosphatase and Exonuclease 1 (New England Biolabs), and sent to ELIM Biopharm for sequencing ...
-
bioRxiv - Cell Biology 2023Quote: cDNA encoding recombinant MUC17(7TR) with N-terminal 3xFlag tag was generated using Gibson Assembly (E2611S, NEB) following the manufactures protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant nanobody-displaying phages were rescued with 2×1011 PFU of M13KO7 Helper phage (New England Biolabs). Rescued phages were suspended in 1 ml of phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... purified ∼25−50-nt RNA fragments underwent treatment with recombinant shrimp alkaline phosphatase (New England Biolabs; M0371) to remove 5’-and 3’-phosphates ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used 50 μL Protein A or Protein G Magnetic beads (NEB) and washed twice with PBS with 5 mg/ml BSA and 4 μg of antibody coupled in 500 μl PBS with 5 mg/ml BSA overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: A 1 kb long DNA fragment with biotin molecules attached to the 5′ termini (dibiotin-DNA) was generated by PCR amplification using Q5 High-Fidelity Polymerase (NEB), with pAM075 as a template and the 5′-biotinylated primer pair oAM091/oAM092 ...
-
bioRxiv - Biophysics 2022Quote: ... the purified 8.2 kb DNA linker was annealed to the oligo DNA handle with 3’-biotin (5’-TGGACTGATGCGGTATCTGCGATATCCTA CGCAGGCGTTT-3’-biotin) in PBS at room temperature for 3 hr followed by purification using Monarch DNA purification kit (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... Klenow was then used to fill in restriction fragment overhangs and mark the DNA ends with biotin (M0210, New England Biolabs). Proximity ligation contact (PLC ...
-
bioRxiv - Genomics 2020Quote: ... the resulting synthetic RNA/DNA hybrid fragment was ligated to both the 600 and 400 bp DNA fragments before ligating a loop (PS359) and Y-shape (triple-biotin/PS866) at either end using T3 DNA ligase (NEB). The hairpins were gel purified and attached to paramagnetic MyOne T1 streptavidin beads (Dynal/Life Tech).
-
bioRxiv - Genomics 2022Quote: The 2.2 kb DNA was ligated with 1 kb biotin- and dig-labeled DNA through SbfI- and XbaI-overhangs by T4 DNA ligase (NEB Biolabs). The ligated products were attached to the anti-dig treated surface of reaction chamber and streptavidin-coated magnetic beads ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Both ends of the 19-mer of the 200 bp 601 DNA were labeled with biotin by Klenow fragment (NEB) with biotin-14-dATP (58) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin labeled nuclei were washed once with 1x NEB ligation buffer and resuspended with ligation mix (100 ul 10x NEB ligation buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 4SU-labeled RNA (100 µg) was biotinylated with HPDP-biotin (cat. 21341, ThermoScientific) and captured on 150 µL of streptavidin magnetic beads (NEB) per RNA sample ...
-
bioRxiv - Neuroscience 2021Quote: ... Lambda Protein Phosphatase (NEB) assay was performed as described by the supplier ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 protein (NEB M0641S) and phenol red injection dye ...