Labshake search
Citations for New England Biolabs :
551 - 600 of 639 citations for Polybrominated Diphenyl Ether Surrogate Spiking Stock 10X Solution 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... 1 μL deoxynucleotide Solution Mix and 0.5 μL Taq DNA Polymerase (New England Biolabs). The reactions were incubated in an Eppendorf Mastercycler Gradient Thermal Cycler for 7m at 95°C ...
-
bioRxiv - Genomics 2019Quote: ... bead-nuclei were resuspended in 190 µL RNA ligase solution (1× RNA ligase buffer (NEB), 4.5 µM bridge adapter ...
-
bioRxiv - Plant Biology 2021Quote: ... mRNAs were isolated from this solution using 50 μ magnetic Oligo(dT)25 beads (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: A working lysis buffer solution was prepared by adding 1 µL of the MNase (NEB) [1:50 dilution] per 5 µL lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... The solution was diluted to 200 μL to yield 1X NEBuffer 1 (NEB, Ipswich, MA) at pH 7.0 ...
-
bioRxiv - Biophysics 2022Quote: An in vitro translation reaction was assembled with the following: 6.4 µL solution A (NEB), 2 µL factor mix (NEB) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Stained cell solution was diluted in a mix with diluent and RNase inhibitor (New England Biolabs) to 1 cell/50 nl for dispensing on the ICELL8-chip (Takara ...
-
bioRxiv - Genomics 2019Quote: ... Transposed DNA was amplified in a solution containing 1X NEBNextHigh Fidelity PCR Master Mix (NEB #M0541L), 0.5 μM of Ad1_noMX universal primer ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg of gp145 in solution were incubated with 50 units of α2-3,6,8,9 NEUA (NEB) for 24 hrs at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Gels were then placed in digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) and digested for 4 hours at room temperature.
-
bioRxiv - Cell Biology 2022Quote: ... 50 µL of the solution was mixed with 15 µL of amylose beads (New England Biolabs). Samples were placed into PierceTM micro-spin columns (Thermofischer ...
-
bioRxiv - Microbiology 2022Quote: ... each chamber is filled for 30 min with a 1 mg/ml solution of Streptavidin (NEB) and then passivated with a blocking solution (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Biophysics 2022Quote: ... cells were incubated in dye solution (1 μM BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Microbiology 2023Quote: ... to 100 μl of RNA solution and cleaned up with a Monarch RNA cleanup kit (NEB). RNA concentrations were measured with a NanoDrop 1000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µL PCR Anchor Primer,1 µL Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, Inc., N0447L), 10 µL Q5® Reaction Buffer (New England BioLabs ...
-
bioRxiv - Plant Biology 2023Quote: ... The solution was then used to transform NEB turbo Escherichia coli competent cells (NEB, MA, USA). pCambia1300/SPRI1A-C+12 was created in our previous study (Fujii et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Gels were then placed in digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) and digested for 4 hours at room temperature.
-
bioRxiv - Genomics 2021Quote: ... Nuclei were subjected to a methylation labeling reaction using a solution of 1x M.CviPI Reaction Buffer (NEB), 300 mM sucrose ...
-
bioRxiv - Genetics 2020Quote: ... 10 mL of a 10% BSA solution was incubated with 2.5 μL of Proteinase K (NEB P8107S) for 30 minutes at room temperature (∼22°C) ...
-
bioRxiv - Biochemistry 2023Quote: ... 50 ul of aqueous solution were recovered and treated with 0.3 U of calf intestinal phosphatase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... beads were washed twice with coIP-solution and finally dissolved in RNA protection buffer (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... and the samples were incubated overnight at 47℃ in clearing solution comprised of Protease K (NEB, P8107S) and Clearing Premix (Vizgen ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting solution was cooled down to 42°C before adding 2 U of β-agarase (NEB), gently mixing the solution by end-over-tube inversion ...
-
bioRxiv - Biophysics 2024Quote: ... solutions containing polySH3 and cleaved MBP- and His6-tags were passed over Amylose resin (New England Biolabs) to remove excess MBP ...
-
bioRxiv - Molecular Biology 2021Quote: ... their nuclei were isolated via centrifugation then resuspended in a 0.5 ml solution comprising 1.2 × restriction enzyme NEBuffer™ r3.1 (NEB) containing 0.3% SDS ...
-
bioRxiv - Cell Biology 2021Quote: ... The cleaved 6xHis-MBP tag was removed by incubating the solution with Ni-NTA magnetic beads (NEB; S1423) for 1 hour at 4 °C ...
-
bioRxiv - Biophysics 2019Quote: ... The coverslips were incubated in staining solution (1 µM benzylguanine Alexa Fluor 647 (S9136S, NEB, Ipswich, MA, USA); 1 mM DTT ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... The wash solution was then replaced with 1× T4 polymerase buffer containing 30 U T4 DNA polymerase (NEB) and incubated at 12 °C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was initiated by diluting the LbCas12a complexes to a final concentration of 37 nM LbCas12a : 37 nM sgRNA in a solution containing 1X NEBuffer 2.1 (NEB) and 1 µM custom ssDNA reporter substrates in a 40 μL reaction volume ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and resuspended in 50 µL of 1 mg/mL RNAse A solution (New England Biolabs, Ipswich, Massachusetts, United States) and statically incubated at 37 °C for 3 h ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Microbiology 2019Quote: ... of desired templates were in vitro-transcribed overnight at 37°C with 2.5 mM Ribonucleotide Solution Mix (New England Biolabs) and when needed ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Genetics 2022Quote: ... Eggs were then injected under air-dry conditions with a solution containing 300ng/μl of recombinant Cas9 Nuclease (NEB) and 100ng/ul each of four sgRNAs targeting the first exon of the Oatp74D gene (S2 Table) ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Microbiology 2023Quote: 10 μM solutions of each protospacer oligonucleotide were end-phosphorylated with T4 polynucleotide kinase (NEB cat. # M0201, Ipswich, MA) for 30 minutes in the presence of 1x T4 ligase buffer then annealed by heating to 95°C in a heat block which was subsequently allowed to cool to room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Genomics 2019Quote: ... Bead-nuclei were pelleted for 2 min at 2500 g and resuspended in 189 µL blunting solution (1× T4 DNA ligase buffer (NEB), 0.25 mM dNTPs ...
-
bioRxiv - Genomics 2019Quote: ... 3’ P ends of RNA were dephosphorylated by resuspending bead-nuclei in 190 µL dephosphorylation solution (1× PNK buffer (NEB), 0.1% Triton X-100 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA oligonucleotides were diluted (and mixed) to the desired concentration in buffer solution with 2 mg/mL BSA (Molecular Biology Grade, New England Biolabs) to minimize DNA adsorption to tubing and pipette tips and loaded to inlet port 3 ...
-
bioRxiv - Biochemistry 2019Quote: ... The site-directed mutagenesis reaction was performed in two parts: (i) diluted mutagenic oligonucleotides were mixed with a master mix solution composed of Hot-start Phusion DNA polymerase (NEB), GC Phusion buffer ...
-
bioRxiv - Genomics 2019Quote: ... solution was diluted 1:20 and 5 μL used in a standard 50 μL PCR reaction using Q5 enzyme (NEB). PCR products were Sanger sequenced and analyzed using SnapGene to identify SNP corrected clones (7/192) ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μL of PCR product were mixed with 5 μL of a 5X Exo-SAP solution (15% Shrimp Alkaline Phosphatase – 1000U/ ml – NEB, 10% Exonuclease I – 20000 U/ ml – NEB ...