Labshake search
Citations for New England Biolabs :
4901 - 4950 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... PCR reactions were carried out using the Q5 High-Fidelity DNA polymerase kit (New England Biolabs (NEB), USA ...
-
bioRxiv - Genomics 2024Quote: ... An NGS library was generated using an NEB Ultra II DNA Library Prep kit (NEB, Ipswich, MA) with an Illumina compatible y-adaptor ...
-
bioRxiv - Genomics 2024Quote: ... WGS libraries were prepared using NEBNext ultra II DNA FS kit (New England Biolabs, Ipswich, MA, USA). In brief ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were quantified using qPCR with the NEBNext® Library Quant Kit for Illumina (NEB, ref E7630L). Pooled libraries containing 2% PhiX were loaded on a NextSeq2000 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were purified after each PCR using the Monarch PCR & DNA Cleanup Kit (New England Biolabs, T1030L).
-
bioRxiv - Neuroscience 2024Quote: ... RNA extraction was performed using the Monarch® Total RNA Miniprep Kit (New England Biolabs, catalog #T2010s) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... The crude circRNA product was on a silica based-column (Monarch RNA cleanup kit, 50 µg, NEB) followed by RP-HPLC ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for bacterial expression were prepared with the Q5 site-directed mutagenesis kit (New England Biolabs Inc.) according to the manufacturers’ protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNA sequencing library was generated using NEBNext® Ultra RNA Library Prep Kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were constructed using the NEBNext Ultra II DNA Library prep kit for Illumina (New England Biolabs). All samples were paired-end sequenced (2×150 bp or 2×250 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... 800 ng RNA were reverse transcribed into cDNA using the LunaScript RT Super Mix Kit (NEB, #E3010) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: scFvs were diversified by mutagenesis as described in the Q5 site-directed mutagenesis kit (New England Biolabs). Mixtures of mutagenic primers were prepared at 1 µM for each primer ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated from the mouse ES cells using the Monarch Total RNA Miniprep Kit (NEB T2010), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were generated using the Next® Ultra RNA Library Prep Kit for Illumina® (NEB) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Mutations to the TXNL1 entry clone were introduced using the Q5 Site-Directed Mutagenesis kit (NEB, E0554S). The PCR primers were designed using the NEBaseChanger program and synthesized by IDT ...
-
bioRxiv - Cell Biology 2024Quote: ... and qRT-PCR was performed in duplicate reactions using the LunaScript® RT SuperMix Kit (NEB, E3010). Expression values were normalized to HRPT-1 and GAPDH levels for GFP+ and tdTomato+ cells ...
-
bioRxiv - Biochemistry 2024Quote: In vitro transcription (IVT) was performed using the Superscript T7 Kit (New England Biolabs, catalog no. E2040S) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries prepared using the Ultra RNA Library Prep Kit for Illumina (E7530L, New England BioLabs) from total RNA (500 ng) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Beyotime) and used as DNA template for in vitro mRNA transcription (HiScribe T7 ARCA mRNA Kit, NEB). FLT3L-CAR mRNA was capped with Anti-Reverse Cap Analog (ARCA ...
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR reactions were carried out using the Luna Universal One-Step RT-qPCR Kit (NEB, #E3005L). Quantification was performed using a SYBR Green-based method on an Eppendorf Realplex Mastercycler (software version 2.2.0.84) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Sequencing libraries were prepared following the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) standard recommendations ...
-
bioRxiv - Genetics 2024Quote: ... or directly after PCR using the Monarch® PCR & DNA Cleanup Kit (New England Biolabs® Inc.).
-
bioRxiv - Evolutionary Biology 2024Quote: ... NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) was used for library preparation following manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II library preparation kits for Illumina (New England Biolabs, Ipswich, MA). The libraries were paired-end sequenced (150 bp ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II library preparation kits for Illumina (New England Biolabs, Ipswich, MA). The completed libraries were paired-end sequenced (150 bp ...
-
bioRxiv - Evolutionary Biology 2024Quote: All PCR amplicons of appropriate sizes were isolated with the Monarch DNA Extraction Kit (New England Biolabs) and sequenced (Eurofins Genomics ...
-
bioRxiv - Developmental Biology 2024Quote: ... and linearly amplified by in vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit, NEB, Cat#: E2040S). The dsDNA was degraded (TURBO DNase Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were made with an NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs, #7765). Obtained reads were deposited in the DRA/SRA database under accession numbers ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sequencing libraries were generated using the NEB Next Ultra II DNA Library Prep Kit (NEB, 7645S), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Mutants of EPHA1 and EPHB4 were generated using the Q5-site directed mutagenesis kit (New England BioLabs): EPHA1-KD (K656A) ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing libraries were generated using a NEBNext®UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitated chromatin was used for NGS library preparation (NEBNext Ultra II DNA Library Prep Kit for Illumina, NEB). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA of all cell lines was isolated using Monarch Total RNA miniprep kits (#T2010S, New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... NGS libraries were prepared using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: Poly-A RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2020Quote: ... Prokaryotic DNA was enriched from the total hindgut DNA extract using NEBNext Microbiome DNA Enrichment Kit (NewEngland BioLabs). Following sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA (XXXXXXXX for KPC1 or CGGCGGCGGGATGTTCGTGC for KPC2) were synthetized in vitro using EnGen sgRNA Synthesis kit (NEB) and purified using RNA clean and concentrator (Zymo Research) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sequencing libraries were constructed with NEB NextR UltraTM DNA Library Prep Kit for Illumina (NEB, United States) following the manufacturer’s instructions and index codes were added ...
-
bioRxiv - Cell Biology 2020Quote: ... The FER1 Ca2+-binding mutants in the C2D domain were generated by Q5 site directed mutagenesis kit (NEB) using primers 4833/4834 to change positions A1622 and A1634 to C resulting in Asp codon 542 and 545 changes to Ala.
-
bioRxiv - Cell Biology 2020Quote: ... Single or double mutations were produced with the Q5® Site-directed Mutagenesis kit (New England Biolabs, UK) using the primers in Table 1.
-
bioRxiv - Cell Biology 2020Quote: ... and pFLOE1p:FLOE1ΔDUF-GFP were obtained by modifying pFLOE1p:FLOE1-GFP using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with primers priDSdeletion-FWD/REV ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645), with adapters diluted 1:5 from the supplied concentration ...
-
bioRxiv - Genetics 2021Quote: ... and stranded RNA-seq libraries were prepared using random hexamer and NEB directional RNA library prep kit (NEB) and sequenced on the NovaSeq 6000 PE150.
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Genetics 2021Quote: ... libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs), using the appropriate protocols for DNA samples of 50 ng (lower input ...
-
bioRxiv - Developmental Biology 2021Quote: ... SWS point mutation of G to A was generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with primers 5’-CATCCAGCGCaGGGTGACAAG-3’ and 5’-TCCTGGAAGGTGGTGGCA-3’ ...