Labshake search
Citations for New England Biolabs :
4851 - 4900 of 10000+ citations for Rat Heat Shock Protein Beta 2 HSPB2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was converted into double stranded blunt-end libraries with Illumina-specific adapters REF using the NEBNext DNA Sample Prep Master Mix Set 2 (E6070S - New England Biolabs Inc., Beverly, MA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplified products were gel purified (Monarch DNA Gel Extraction Kit, New England Biolabs) and incubated with 100 ng XbaI- and XhoI-digested pYL156 in a molar ratio of 1 vector ...
-
bioRxiv - Plant Biology 2019Quote: Small RNA sequencing libraries were prepared using the NEBNext Small RNA kit (NEB, E7300L) according to manufacturer’s recommendations and sequenced by either the University of Missouri DNA Core or the University of Arizona Genetics Core with either an Illumina HiSeq2500 or NextSeq500 ...
-
bioRxiv - Bioengineering 2021Quote: ... The PCR product was gel extracted with the Monarch DNA Gel Extraction Kit (NEB). 20,000 HEK-293FT cells were plated into 96 well plates ...
-
bioRxiv - Microbiology 2020Quote: DNA amplification was performed using the Q5 DNA polymerase kit (New England Biolabs, USA) and the corresponding primers (Table S3 ...
-
bioRxiv - Microbiology 2020Quote: ... was made by mutagenesis PCR using the site-directed mutagenesis kit (New England Biolabs). Additional mutants of this intermediate vector were generated through site-directed mutagenesis of the HHRz sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... fragmented mRNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB), by omitting the RNA fragmentation step and following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (NEB, E7645) and sequenced on an Ilumina NextSeq 550 with 75 bp single-end reads ...
-
bioRxiv - Developmental Biology 2021Quote: ... The first strand cDNA was synthetized using ProtoScript II kit (New England Biolabs, USA) from 1 μg of total RNA or 1.5 ng of mRNA with Random Primer Mix (2 and 0.5 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was rRNA depleted using NEBNext rRNA Depletion Kit (New England BioLabs, E6310L). 1st strand cDNA was generated using Maxima H minus First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted using the Monarch Genomic DNA purification kit (New England Biolabs). 400ng genomic DNA was used to construct whole-genome bisulfite libraries ...
-
bioRxiv - Genetics 2021Quote: ... and sequencing libraries were generated using the NEBNext Ultra DNA Library prep kit (NEB) and NEB multiplex oligos (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were prepared using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB) (zebrafish ...
-
bioRxiv - Microbiology 2020Quote: ... All reactions were performed using the LongAmp® Taq PCR Kit (New England Biolabs). Amplification conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Different KRAS mutants were generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S). The successful clones were confirmed using DNA sequencing.
-
bioRxiv - Molecular Biology 2021Quote: ... and subjected to DNA library preparation via the NEBNext Ultra II kit (NEB, E7645L). Libraries were pooled at equimolar concentrations and sequenced via an Illumina NextSeq 500 system using paired end 150 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... Mutants of the bGSDM genes were constructed using Q5 Site-directed Mutagenesis kit (NEB). The Runella bGSDM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Library concentration was determined by NEBNext Library Quant Kit for Illumina (New England Biolabs). Paired end sequencing (76 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... Connecting the DNA segments was performed using the NEBuilder HiFi DNA Assembly Kit (NEB) or Ligation high Ver.2 (TOYOBO) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the FLuc Control Template from the HiScribe T7 high yield RNA synthesis kit (NEB) was in vitro transcribed and purified as described the linearized pTXB1 vector.
-
bioRxiv - Neuroscience 2022Quote: ... were produced by using in vitro transcription HiScribe™ T7 ARCA Kit (NEB, E2060S) following the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR product was transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Bromodomain mutants were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) and each mutation was confirmed through DNA sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... sequencing using NEBNext UltraII DNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and the digestion product was purified using Monarch PCR & DNA Cleanup Kit (NEB, T1030S). Following the preparation of both the backbone vector and insert ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA purification was performed using the Monarch PCR & DNA Cleanup Kit (NEB, Ipswich, USA). Libraries were then amplified and purified before being size selected using magnetic AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by library preparation with NEBNext Ultra II DNA Library Prep Kit Illumina (NEB). The library was sequenced on HiSeqV4 (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... ChIP-seq libraries were prepared using NEBNext Ultra DNA Library Prep Kit Illumina (NEB) and sequenced on HiSeqV4 (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were prepared using the NEBNext UltraII DNA library prep kit for Illumina (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Other constructs were created using a Gibson assembly cloning kit (E5510; New England Biolabs). All DNA fragments were inserted into the GFP vector backbone pPD95.77 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mRNAs were isolated from total RNA using a Magnetic mRNA isolation kit (S1550S, NEB), and libraries were prepared using a NEXTflex Rapid directional RNA-seq kit (5138-08 ...
-
bioRxiv - Molecular Biology 2021Quote: ... In vitro translation was carried out in 10 µL using the PURExpress kit (NEB) according to the commercial protocol in the presence of a mix of 32P-radiolabeled cspA mRNA (200000 cpm/µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... WGS libraries were generated using the NEBNext Ultra II DNA Library Prep kit (NEB) according to manufacturer’s recommendation with 1µg input material ...
-
bioRxiv - Genomics 2022Quote: ... Guide RNAs were in-vitro synthesized using Engen gRNA synthesis Kit (New England Biolabs) according to the manufacturer instruction with synthesis of the double stranded DNA template and transcription of RNA in a single reaction ...
-
bioRxiv - Genomics 2022Quote: ... Guide RNAs were then purified using Monarch RNA Cleanup Kit (New England Biolabs T2040L) per manufacturer instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were constructed using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with each pool indexed with a unique dual barcode (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Genomics 2020Quote: ... we used the NEBNext Ultra II FS DNA library kit (New England Biolabs, Inc); the initial enzymatic shearing step was accomplished via 10 minutes of incubation at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... mRNA isolation module in conjunction with their Ultra II RNA directional kit (NEB, E7760) was used to generate libraries for sequencing ...
-
bioRxiv - Immunology 2021Quote: ... cDNA library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and sequenced on NextSeq 500 System (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, MA, USA) was used to generate sequencing libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μg of samples were processed using a commercially available kit (New England Biolabs), PrPC detection was performed using the monoclonal anti-PrPC antibody POM2 as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... All minigene mutations were introduced via Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The nine mutations from eight patients in Orlando et al ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNAs were prepared using the EnGen™ sgRNA Synthesis Kit (New England BioLabs), along with a sg control (g-control- CATCCTCGGCACCGTCACCC) ...
-
bioRxiv - Cancer Biology 2019Quote: ... site-directed mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs) using the primers ACTTGGACGAGCTATTGGAGAAGGC ...
-
bioRxiv - Genomics 2019Quote: ... DNA was repaired and dA-tailed using PreCR and FFPE kits (New England Biolabs) and cleaned with Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2019Quote: ... The mutations were made using the Q5 site directed mutagenesis kit (New England Biolabs). The constructs contained the promoter from the maternal alpha tubulin gene ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The parts were assembled using the NEB HiFi DNA Assembly kit (New England Biolabs) with an incubation time of one hour at 50°C ...
-
bioRxiv - Microbiology 2019Quote: ... Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs GmbH; Ipswich, USA), or innuPREP DOUBLEpure Kit (Analytik Jena ...