Labshake search
Citations for New England Biolabs :
4951 - 5000 of 10000+ citations for Rat Heat Shock Protein Beta 2 HSPB2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Thermo-Fisher) and simultaneously Gibson assembled (NEBuilder HiFi DNA Assembly kit; New England Biolabs) into the pBAD and pBGC backbones using the primers listed in Table S4 to give rise to pBAD and pBDSM plasmids carrying mutated alleles of the cI-tetA system (Figure S1 and Table S3).
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 3 thermocycler ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs), following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA). Sequencing was performed on either the NextSeq500 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... using the NEBNEXT Ultra II RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... and double-strand cDNA was synthesized using NEBNext mRNA second strand synthesis kit (NEB). Cleaning was done using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2022Quote: ... The RNA transcripts were purified using the Monarch RNA Cleanup Kit (New England Biolabs). RNA concentrations were determined using Qubit RNA BR Assay Kit (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... Reaction products were gel purified using the Monarch Gel Purification kit (New England Biolabs) and Sanger sequenced using oligos OFA1204 and OFA1206 to confirm both the sequence of the RPT6 promoter and the synonymous substitutions in the RPT6 ORF ...
-
bioRxiv - Cell Biology 2022Quote: ... Libraries were prepped with the NEB Ultra II stranded mRNA Library prep kit (NEB). RNA-Seq libraries were sequenced with NextSeq ...
-
bioRxiv - Genomics 2022Quote: ... or tail chip using Monarch Genomic DNA Purification Kit (Cat# T3010S, New England Biolabs) and digested by Pst I (Cat# R3140S ...
-
bioRxiv - Molecular Biology 2022Quote: ... the digested DNA fragment and pET28a were ligated using the quick ligation kit (NEB). The resulting construct was selected on LB agar plates supplemented with kanamycin (20 μg/ml ...
-
bioRxiv - Genomics 2022Quote: ... This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB]) for domain addition / removal or single amino acid substitutions ...
-
bioRxiv - Genomics 2022Quote: ... This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB]) for domain addition / removal or single amino acid substitutions ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were converted for sequencing with the NEBNext enzymatic methyl-seq kit (NEB) and sequenced at the University of Minnesota Genomics Center ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA-free RNA was purified using Monarch RNA Clean-up Kit (New England Biolabs) and visualised on an agarose gel.
-
bioRxiv - Microbiology 2022Quote: ... and cloned into a pVFT1S expression vector using a HiFi DNA Assembly kit (NEB). Both nsp10 and nsp14 contained an N-terminal 6x-His tag ...
-
bioRxiv - Genomics 2022Quote: ... and poly-A tailed using the HiScribe™ T7 ARCA mRNA Kit (NEB, E2065S) with 50% supplement of 5-Methyl-CTP and Pseudo-UTP (Jena Biosciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... CENP-U250-418) were generated using a HiFi DNA assembly kit (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... the library concentration was qPCR measured by NEBNext Library Quant Kit (New England BioLabs) using QuantStudio 5 Real-Time PCR Systems (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: HEV and FCV transcripts were generated using the HiScribe T7 ARCA mRNA kit (NEB) using 1 μg of linearised plasmid template following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... for both RubPro and RubProHel using Q5 Site-directed Mutagenesis Kit (New England BioLabs). The forward and reverse primer used were TCCCAACACTGCGTGGCTGAGAGCCGCCG and TCGAGTTCCCCGCCCCTT respectively ...
-
bioRxiv - Microbiology 2022Quote: ... The fragment was gel purified using Monarch DNA Gel Extraction Kit (New England Biolabs), and Sanger sequencing was performed using BigDye Terminator v3.1 and either the forward or the reverse primer ...
-
First De novo whole genome sequencing and assembly of mutant Dendrobium hybrid cultivar ‘Emma White’bioRxiv - Genomics 2022Quote: ... A DNA sequencing libraries were prepared using a DNA library preparation kit (NEB NextUtra) and tested with Agilent Tapestation for quality validation ...
-
bioRxiv - Cancer Biology 2022Quote: ... First-strand cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB, cat. E3010S). qPCR was performed on a QuantStudio 3 or StepOnePlus real-time PCR machine using TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... The nucleosomes were assembled using the EpiMark® Nucleosome Assembly Kit (New England Biolabs) following the kit’s protocol.
-
bioRxiv - Genomics 2021Quote: ... we prepared 36 libraries using the NEBNext Ultra ChIP-seq kit (New England Biolabs) and sequenced libraries on the Illumina HiSeq 2500 sequencer using the 2×150-bp mode ...
-
bioRxiv - Microbiology 2020Quote: ... and poly(A)+ mRNA selected using the NEB Magnetic mRNA Isolation Kit (NEB S1550S).
-
bioRxiv - Microbiology 2021Quote: ... followed by purification with the Monarch PCR and DNA Cleanup Kit (New England Biolabs). The purified products were submitted for Sanger sequencing at Laragen ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) and qPCR performed using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were prepared using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB) (zebrafish ...
-
bioRxiv - Molecular Biology 2019Quote: ... and amplified/indexed by PCR with the NEBNext DNA Library Prep Kit (NEB E6040). Samples were sequenced using a NextSeq 500/550 75 cycle kit (Illumina TG-160-2005) ...
-
bioRxiv - Genomics 2020Quote: ... DNA was then eluted and purified for library preparation with NEBNext Ultra kits (NEB).
-
bioRxiv - Genomics 2020Quote: ... The libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (NEB) followed by NG sequencing using the Illumina HiSeq X Ten system ...
-
bioRxiv - Immunology 2021Quote: ... CD4 domain deletion mutants were generated using the Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufactureŕs protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... The tags were removed using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) to generate wild-type ...
-
bioRxiv - Molecular Biology 2020Quote: Some cloning reactions were carried out with NEBuilder HiFi DNA assembly cloning kit (NEB) while others were made by conventional means ...
-
bioRxiv - Immunology 2020Quote: The PCR products were cleaned using the Monarch® DNA Gel Extraction Kit (NEB), and 3’ end A-overhangs were added by NEBNext® dA-Tailing Module (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... In vitro transcription was performed using HiScribe Quick T7 kit (New England Biolabs #E2050S) following the manufacturer’s directions and incubating for 3 hr at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesis and amplification were performed with Next Ultra RNA Library Preparation Kit (NEB). Libraries were sequenced on a HiSeq3000 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermo-cycler ...
-
bioRxiv - Microbiology 2021Quote: ... This preparation was conducted with the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... 900 ng RNA was depleted of rRNA using the NEBNext rRNA Depletion kit (NEB). RNA-seq libraries were prepared from an equal amount of ribo-depleted RNA using the NEBNext Ultra II Directional RNA Library Prep kit ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA fragments were assembled using NEBuilder HiFi DNA Assembly kit (New England Biolabs) and the plasmid was transformed into E ...
-
bioRxiv - Microbiology 2022Quote: ... Illumina libraries were prepared with NEBNext Ultra DNA Library Prep Kit (New England Biolabs). DNA samples were fragmented in a Covaris instrument and sequenced on an Illumina MiSeq device as paired-end reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB). Library quality was assessed using the Ilumina Bioanalyser 2100 system (Agilent Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... ChIP-seq libraries were constructed using the NEBNext Ultra II DNA Kit (NEB, E7645).
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were prepared using NEBNext Ultra II RNA library prep kit (NEB E7770S) and sequenced by the Illumina NovaSeq 6000 with 100bp paired end reads ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs were performed using the Luna® Universal One Step RT-qPCR Kit (NEB) in a ThermoFisher Quantstudio 3 instrument ...
-
bioRxiv - Systems Biology 2022Quote: ... the probes were purified with the Monarch® RNA Cleanup Kit (500 μg, NEB).